Информация

В чем разница между мутацией на пару оснований и мутацией на геном?

В чем разница между мутацией на пару оснований и мутацией на геном?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Разве размер генома не считается количеством пар оснований, присутствующих в ДНК? Так в чем же разница между мутацией на пару оснований и мутацией на геном? Они похожи или разные?


Это разные нормализации одного и того же числа. Вопрос в том, хотите ли вы знать, сколько мутаций можно ожидать в одной позиции в геноме, или вы хотите знать, сколько мутаций происходит во всем геноме.

См., Например, википедию:

Для каждой из этих скоростей существует несколько естественных единиц времени, причем скорости характеризуются либо мутациями на пару оснований на деление клетки, на ген на поколение или на геном на поколение.

Мутации на геном - это количество мутаций на пару оснований, умноженное на количество пар оснований в геноме (плюс мутации, которые не соответствуют заменам пар оснований, хотя они обычно игнорируются в этих измерениях).

Например., $10^{-9}$ мутации на пару оснований в геноме из 3 миллиардов пар оснований соответствуют $3$ мутации на геном.


Скорость мутации

В генетике скорость мутации это мера скорости, с которой различные типы мутаций происходят в течение некоторой единицы времени. Скорости мутаций обычно указываются для конкретного класса мутаций, например точечных мутаций, мелких или крупных вставок или делеций. Скорость замен можно далее подразделить на спектр мутаций, который описывает влияние генетического контекста на скорость мутаций.

Для каждой из этих скоростей существует несколько естественных единиц времени, причем скорости характеризуются либо мутациями на пару оснований на деление клетки, на ген на поколение или на геном на поколение. Скорость мутации организмов - это эволюционная характеристика, на которую сильно влияет генетика каждого организма, в дополнение к сильному влиянию окружающей среды. Верхний и нижний пределы, до которых может развиваться частота мутаций, являются предметом текущих исследований.


Оценка скорости мутации пары оснований в дрожжах Saccharomyces cerevisiae

Хотя частота мутаций является ключевым фактором скорости эволюции, их трудно точно измерить, и глобальные скорости мутаций (мутации на геном на поколение) часто экстраполируются из скорости мутаций на пару оснований, предполагая, что скорость мутаций одинакова по геному. . Используя почкующиеся дрожжи, мы описываем улучшенный метод точного расчета частоты мутаций на основе анализа флуктуации. Наш анализ показывает, что частота мутаций на пару оснований в двух генах значительно различается (3,803 · 10 · 10 · 10 · 10).вURA3и 6,4431010вCAN1) и предлагаем определение эффективного размера цели генов (вероятность того, что мутация инактивирует ген), который подтверждает, что скорость мутации неоднородна по всему геному.

эволюция. Он ограничивает скорость адаптации популяций с полезными мутациями при отсутствии полезных мутаций. Он устанавливает равновесную приспособленность популяции. Несмотря на его важность, существуют большие неточности в оценке частоты мутаций генома на поколение. Оценка этого параметра, как правило, представляет собой трехэтапный процесс: определение скорости мутации для определенного фенотипа, преобразование этой фенотипической скорости в частоту мутаций на пару оснований в конкретном гене и экстраполяция этой локальной скорости на всю геном. В этой статье мы сосредоточимся на технической задаче точного определения скорости фенотипических мутаций и аналитической задаче определения эффективного целевого размера гена, вероятности того, что мутация где-то в определенном сегменте генома вызывает мутация с указанным фенотипическим эффектом.

Для измерения скорости фенотипических мутаций обычно используются три метода: накопление мутаций, как говорится, накопление мутантов, как говорится, и тесты флуктуации. Анализ накопления мутаций включает прохождение культуры через повторяющиеся узкие места, в идеале одной клетки / индивидуума, так что все мутации почти нейтральны. Это полезно для определения скорости мутаций, влияющих на приспособленность, поскольку повторяющиеся узкие места уменьшают эффект отбора (Kibotaand Lynch1996 Zeyl and Devisser2001). Этот метод хорошо работает в многоклеточных организмах, где размер популяции может поддерживаться в узком месте, однако у микроорганизмов, где необходимо позволить сформироваться видимой колонии, отбор по-прежнему будет происходить между узкими местами. Несколько

доступны методы оценки скорости фенотипических мутаций на основе анализов мутамутации-накопления (Garcia -Dorado and Gallego, 2003). В качестве альтернативы можно использовать прямое секвенирование, поскольку все мутации происходят в одном и том же геноме (Denveret al, 2004 Haag -Liautardet al.2007).

В анализе накопления мутантов частота фенотипа, который является нейтральным в среде эксперимента, но может быть выбран в альтернативной среде, отслеживается в экспоненциально растущей культуре путем периодического высева аликвоты культуры на селективную среду. . Как только популяция достигнет такого размера, что вероятность появления новой мутации в следующем поколении равна приблизительно единице, частота мутантов будет линейно увеличиваться со временем. Таким образом, точная оценка частоты фенотипических мутаций требует длительных интервалов между измерениями частоты, а эти эксперименты обычно длятся в течение сотен поколений. Поскольку большая часть населения не накопила нейтральную мутацию, полезные мутации будут преимущественно возникать в клетках, в которых отсутствует нейтральная мутация, что замедляет накопление мутантов.

В анализе флуктуации многие параллельные культуры инокулируют небольшим количеством клеток, выращивают в неселективных условиях и высевают для отбора мутантов (Luriaand Delbruck1943). Количество мутаций, возникающих в каждой культуре, будет соответствовать распределению Пуассона, однако количество мутантных клеток в культуре будет сильно варьироваться, поскольку ранние мутации приведут к «джекпотам» - культурам, которые содержат очень много мутантных особей.

Самый простой способ оценить ожидаемое количество мутаций, которые происходят в каждой культуре (m), - это фракция культур с нулевым количеством мутантов, которая должна быть em.. Этот способ (

P0) использовали Лурия и Дельбрюк (1943) в их оригинальной статье, описывающей флуктуа-1.Автор, ответственный за переписку:Кафедра молекулярной и клеточной биологии,

Гарвардский университет, Divinity Ave, 16, комната 3000, Кембридж, Массачусетс 02138. Электронная почта: [email protected]

пробирный. Полное распределение мутантов по культуре (распределение Луриа-Дельбрюка) может быть описано с помощью набора рекурсивных уравнений (Maet al.1992). Наиболее точный метод оценки m (максимальное правдоподобие Ма – Сандри – Саркара) находит их, которые наилучшим образом соответствуют данным распределения Луриа – Дельбрюка (Саркар и др., 1992, Roscheand Foster, 2000). Путем моделирования Стюарт (1994) вычисляет 95% доверительные интервалы, полученные с помощью этого метода, однако, чтобы доверительные интервалы были значимыми, данные должны соответствовать распределению Луриа-Дельбрюкка.

Один из способов оценить качество данных - построить кумулятивное распределение частот мутантов на логарифмическом графике. Данные, распределенные по Лурии-Дельбрюкку, представленные таким образом, дадут прямую линию с наклоном 1 (Roscheand Foster 2000). Отклонения от линейности показывают, что данные не аппроксимируют распределение Луриа-Дельбрюка. Этот графический подход игнорирует джекпоты (поскольку они лежат далеко от линии) и культуры с нулевым количеством мутантов (из-за преобразования журнала). В этой статье мы представляем основанный на моделировании подход к определению качества данных из анализов флуктуаций и показываем, как этот метод может обнаруживать отклонения от распределения Луриа – Дельбрюка.

Чтобы преобразовать частоту фенотипических мутаций в частоту мутаций на пару оснований, нам необходимо оценить эффективный размер мишени для фенотипической мутации. Хотя концепция эффективного размера мишени важна в эволюционной теории - она ​​связывает частоту мутаций с конкретным фенотипом и частотой мутаций на геном на поколение - она ​​не была четко определена. В предыдущей работе «целевой размер» использовался для обозначения размера гена, в котором выбираются мутации (Drake1991), но также можно было описать количество обнаруживаемых мутаций в репортере. Мы предлагаем более общее и вероятностное определение эффективного размера мишени, которое включает взаимосвязь между частотой фенотипических и геномных мутаций. Наше определение показывает, где возникают неопределенности в оценке частоты геномных мутаций, и показывает, как этот параметр может быть рассчитан на основе экспериментальных данных. В частности, мы различаем эффективный размер мишени, основанный на средней скорости мутаций на геном, и локус-специфический эффективный размер мишени, обусловленный событием мутации, происходящим в определенной области генома.

Мы измерили частоту мутаций устойчивости к 5-фтороротовой кислоте (5-FOA), канаванину и α-фактору. 5-FOA нетоксичен, но может превращаться в токсичный 5-фтор-урацил путем биосинтеза урацила. Продукт генаURA3 катализирует ключевой этап в этом процессе, поэтому 5-FOA преимущественно выбирает мутанты с потерей функции forura3. Канаванин - токсичный аналог аргинина, для поглощения которого требуется переносчик аргинина. Канаванин отбирает мутантов с потерей функции этого переносчика, который кодируется геном CAN1. Α-Фактор представляет собой пептидный феромон, секретируемый клетками спаривающегося типа (MATa). Связывание феромона с рецептором Ste2 на

aMATacell передает сигнал через каскад MAP-киназ, чтобы инициировать гены ответа на спаривание и G1arrest (Dohlman

2002). Клетки MATa дикого типа секретируют протеазу Bar1, которая разрушает фактор-фактор BAR1, предотвращает рост на среде, содержащей альфа-фактор, и позволяет нам измерить степень устойчивости к альфа-фактору с помощью анализа флуктуации. Существует как минимум 10 генов, потеря функции которых приводит к устойчивости к α-фактору, поэтому мы ожидаем, что частота мутаций устойчивости к α-фактору будет на порядок выше, чем частота мутаций к устойчивости к 5-FOA и канаванину. Мы обнаружили, что частота фенотипических мутаций к 5-FOA, канаванину и устойчивости к α-фактору составляет 5,43 3108, 1.52 3 107, и 3,07 3 106/ геном / поколение соответственно. Комбинируя наши оценки частоты фенотипических мутаций и локус-специфичных эффективных размеров мишеней, мы заключаем, что частота мутаций на пару оснований atURA3 и CAN1 составляет 3,803 · 10 · 10а также 6.4431010/ bp / generation соответственно, предполагая, что частота мутаций варьируется в геноме дрожжей.

Штаммы и среда: GIL104 представляет собой гаплоидный штамм дрожжей, полученный из фона W303 с генотипамиURA3, leu2, trp1, CAN1, ade2, his3, bar1DTADE2, MATa. Дрожжи выращивали в

синтетическая полная (SC) среда (Sherman et al., 1974), SC

среда без урацила (SCUra) или среда SC только с 1% глюкозы (SCLG). Культуры, входящие в состав анализов флуктуации, высевали на четыре типа селективных сред: 13

canavanine 1/2SC среда без аргинина (SCArg), 60 мг / л 1-канаванин (Sigma-Aldrich, Сент-Луис) 103

(SCArg, 0,6 г / л · л-канаванин) 5-FOA ½SCUra, 1 г / л

5-FOA (Sigma-Aldrich) и экстракт дрожжевого α-фактора, пептон, декстроза (YPD), 10 мг / мл-фактор (Bio-Synthesis, Lewisville, TX). При подготовке к посеву нескольких пятен мутантных культур на каждую чашку чашки пересушивали, вдавливая фильтровальную бумагу Whatman (степень 3, 90 мм) на чашки, используя блок для нанесения реплик и давая фильтру оставаться на месте в течение не менее 30 мин. Фильтры удаляют 1 мл жидкости, и планшеты можно использовать в течение нескольких дней после снятия фильтров.

Анализы флуктуации. Анализы флуктуации проводили на 10 клонах GIL104, чтобы определить скорость, с которой клетки мутировали, чтобы стать устойчивыми к 5-FOA, 103 канаванину или или фактору. Объемы сред и культур были выбраны таким образом, чтобы для каждого фенотипа можно было подсчитать аналогичное количество мутантов: 200 мл SC, 100 мл SC и 10 мл SCLG для устойчивости к 5-FOA, 103 канаванину и α-фактору соответственно.

(шесть точек на чашку) 100-миллилитровые культуры были нанесены на восемь чашек с 103 канаванином (девять точек на чашку), а 10-миллилитровые культуры были доведены до 100 мл стерильной водой и нанесены на восемь чашек с a-фактором (девять точек на чашку). ). Погрузочно-разгрузочное устройство Tecan Genesis (Tecan USA, Дарем, Северная Каролина) использовалось для полуавтоматической точечной металлизации. Мы предполагаем, что потеря мутантных клеток из-за испарения, обращения с жидкостью и неполной эффективности посева пренебрежимо мала. В используемых условиях среднее количество клеток на культуру составляло 2,13 · 107., 1.33107, и 3,8 3 105, для 5-FOA, 103 канаванин и а-фактор, соответственно.

Планшеты оставляли сохнуть в течение ночи при комнатной температуре, а затем инкубировали при 30 ° в течение 1, 2 или 5 дней для фактора 103.

канаванин и 5-FOA, соответственно, после чего количество мутантов на пятно подсчитывали с помощью диссекционного микроскопа. Для чашек с 103 канаванином и α-фактором мы использовали порог размера: предполагалось, что колонии, 1 мм при 103 увеличении для канаванина или 3 мм при 63 увеличении для фактора, являются результатом мутаций, которые произошли после посева клеток, и не учитывались. Выбор порогового значения размера был основан на поиске естественного разрыва в распределении размеров колоний. Однако распределение колоний по размеру не было бимодальным, поэтому разумно предположить, что некоторые дырявые мутанты были исключены. Это становится очевидным, когда мы наблюдаем джекпоты с мутантами меньше нашего порогового размера, которые были исключены из анализа. По этой причине важно, чтобы штаммы, которые мы секвенировали для определения размера мишени, были выбраны из планшетов из анализов флуктуации, чтобы любые протекающие мутанты, которые были исключены из определения скорости мутации, также были исключены из расчета целевой размер. Анализы флуктуации устойчивости к 13 канаванину были выполнены аналогично анализу для 103 канаванина, за исключением 13

Количество чашек канаванина подсчитывали через 3 дня после посева.

Анализ данных о колебаниях: данные о колебаниях были проанализированы методом максимального правдоподобия Ма – Сандри – Саркара, в котором данные соответствуют модели распределения Луриа – Дельбрюка на основе одного параметра - ожидаемого числа мутаций. событий по культуре (Sarkaret al.1992).

Скорость мутации рассчитывается по уравнению m¼m / N, где N - среднее количество клеток на культуру (приблизительно равно количеству делений клеток на культуру, поскольку исходный посевной материал намного меньше, чем N). Девяносто пять процентов доверительных интервалов для команды были назначены с использованием уравнений 29 и 30 из Foster (2006).

Данные также были подогнаны к двухпараметрической модели, которая учитывает постпластерный рост. Это модель Luria–

Распределение Дельбрюка, наложенное на распределение Пуассона с коэффициентом Nmd¼md, где - среднее число клеточных делений (в которых могут возникать и обнаруживаться мутанты) в линии клеток, которые были высеяны на селективные планшеты, d может быть связано с числом поколений клеток. постплантация (г) byd¼ 2g 1. Распределение вероятностей количества мутантов.

на культуру в двухпараметрической модели, таким образом, совместное распределение Луриа-Дельбрюка (параметр m) и Пуассона (параметр md) одинаковы при условии, что частота мутаций одинакова для делений клеток после посадки.

Мы использовали два теста, чтобы оценить, какая модель лучше всего соответствует данным: одно- или двухпараметрическая. Оба основывались на вычислении вероятности восстановления наблюдаемых данных с учетом модели. Эта вероятность, Pj, где j - количество параметров в модели, рассчитывалась как Pj ¼Pmax

N i, где pi - вероятность наблюдения имутантов, а N - количество независимых культур, которые продуцируют колонии имутантов. Тест отношения логарифма правдоподобия вычисляет L¼2 (log (P2) log (P1)),

который распределяется как x2-распределение с 1 ф.р. Акаике информационный критерий (AIC) вычисляет параметр AIC¼ 2j2 (log (Pj)) и утверждает, что наилучшим соответствием является тот, который имеет наименьшее значение AIC. TheFtest не подходит для этих сравнений, поскольку он предполагает линейную модель с ошибками, взятыми из одного и того же нормального распределения в каждой точке данных, причем оба допущения нарушаются данными, полученными из анализов флуктуаций.

Секвенирование мутантов ura3 и can1: в таблице 1 перечислены праймеры, которые были использованы для амплификации и секвенирования аллелей theura3 и can1 из 5-FOA и 103 устойчивых к канаванину колоний, соответственно. Перед выделением геномной ДНК колонии, устойчивые к 5-FOA и 103 канаванину, пересеивали на селективной среде.

Вычислительный анализ: анализ максимального правдоподобия Ма – Сандри – Саркара и двухпараметрическая аппроксимация были выполнены в Matlab (MathWorks, Натик, Массачусетс). Подгонка к двухпараметрической модели была достигнута за счет оптимизации m (с фиксированным d), оптимизации d (с фиксированным значением) и повторения этого процесса до сходимости. AIC использовался, чтобы определить, какая модель лучше всего соответствует данным (Akaike1974). Matlab также использовался для

моделировать данные о флуктуациях, вычислять разницу в сумме квадратов между распределениями и данными Луриа – Дельбрюка, а также оценивать эффективные целевые размеры для получения 95% доверительных интервалов. Файлы Matlab для большинства этих операций доступны по адресу http://murraylab.mcb.harvard.edu/fluctuation/ programs.htm.

Праймеры, использованные в этом исследовании

Название праймера Последовательность Назначение

URA3extF 59ATCAAAGAAGGTTAATGTGG 39 ПЦР

URA3extR 59TCATTATAGAAATCATTACG 39 ПЦР / секвенирование

URA3extF3 59TTGATTCGGTAATCTCCGAG 39 Секвенирование

URA3intF2 59TGGGCAGACATTACGAATGC 39 Секвенирование

URA3intR2 59CAAACCGCTAACAATACCTG 39 Секвенирование

CAN1extF2 59TCTTCAGACTTCTTAACTCC 39 ПЦР

CAN1extR2 59ATAGTAAGCTCATTGATCCC 39 ПЦР / секвенирование

CAN1ext / intF1 59AAAAAAGGCATAGCAATGAC 39 Секвенирование

CAN1intF2 59GACGTACAAAGTTCCACTGG 39 Секвенирование

CAN1intF3 59TCAAAGAACAAGTTGGCTCC 39 Секвенирование

CAN1intR2 59TAGATGTCTCCATGTAAGCC 39 Секвенирование

Анализы флуктуаций и частота фенотипических мутаций:

Точность оценок частоты мутаций на основе анализов флуктуаций зависит от того, как проводится эксперимент и как анализируются данные. Мы внесли улучшения в оба и рассматриваем каждый по очереди.

Проведение флуктуационных анализов: один из способов повысить точность оценок частоты мутаций на основе флуктуационных анализов - увеличить количество культур (Стюарт, 1994). Обычно анализы флуктуаций проводят в пробирках, однако для увеличения производительности мы проводим анализы в 96-луночных планшетах. Мы переносим 72 культур на селективную среду, чтобы определить количество мутантов на культуру, остальные 24 использовали для определения среднего количества клеток на культуру (возможные материалы и методы). Используя 96-луночный формат, мы можем варьировать

объем культуры от 10 до 200 мл и может измерять скорость мутаций более двух порядков (таблица 2). Вместо того, чтобы вносить культуры в селективную среду, мы наносим культуры на пересушенные чашки, где они равномерно распределяются по площади 1,3–3 см2., в зависимости от на томе подмечено. Это увеличивает эффективность и уменьшает количество чашек, поскольку на одну чашку можно вносить до девяти культур.

Комбинация точечного посева и 96-луночного формата позволяет автоматизировать анализ флуктуаций. Чтобы продемонстрировать это, мы частично автоматизировали процесс с помощью устройства для обработки жидкости, что позволило нам выполнять все описанные здесь флуктуационные анализы - эквивалент трех анализов флуктуаций с 720 пробирками - параллельно.

Анализ данных о колебаниях и постплантационный рост на 13

канаванин: Существует множество методов расчета частоты мутаций на основе данных о флуктуациях (Foster 2006), из которых предпочтительнее метод максимального правдоподобия Ма – Сандри – Саркара, поскольку он является наиболее точным,

действительно для любого диапазона ожидаемого числа мутационных событий на культуру (m), и 95% доверительные интервалы могут быть рассчитаны с помощью эмпирически определенного набора уравнений (Stewart1994 Roscheand Foster2000). Чтобы оценки частоты мутаций и 95% доверительных интервалов, полученные с помощью этого метода, были точными, данные должны приближаться к распределению Луриа-Дельбрюка. Мы протестировали это приближение, используя метод максимального правдоподобия Ма – Сандри – Саркара для оценки, а затем построили прогнозируемое кумулятивное частотное распределение мутантов против экспериментальных данных. Анализ флуктуации 5-FOA показал близкое соответствие между предсказанным и наблюдаемым распределениями (рис. 1). Напротив, анализы 13 канаванина и α-фактора дали данные, которые значительно отклоняются от распределения Луриа-Дельбрюкка. По сравнению с ожидаемым распределением, культуры с небольшим количеством мутантов недостаточно представлены, а культуры со многими мутантами чрезмерно представлены в эксперименте с 13 канаванином (рис. 1, однопараметрическая модель). Это отклонение можно объяснить как комбинацию распределения Луриа – Дельбрюка и распределения Пуассона.

Одно из возможных объяснений состоит в том, что чувствительные к канаванину клетки могут делиться и давать устойчивые к канаванину мутации после того, как они были посеяны, количество дополнительных мутантных колоний будет следовать распределению Пуассона. Мы подогнали распределение частот мутантов к двухпараметрической модели, которая включает постплантационный рост и мутации. Эта модель является совместным распределением распределения Луриа – Дельбрюка (с параметром m) и распределения Пуассона (с параметром etern¼md). Данные 13канаванина лучше соответствовали двухпараметрической модели (рис. 1).

Мы оценили улучшение подгонки двумя методами. Во-первых, это сравнение наилучшего логарифмического правдоподобия

Частота фенотипических мутаций

Скорость мутации (мутации / геном / поколение)

A 5,51 (4,31–6,82) 2,08 (1,67–2,51) 6,49 (4,89–8,24)

B 5,51 (4,31–6,81) 1,81 (1,44–2,20) 4,77 (3,53–6,15)

С 6,28 (4,96–7,70) 2,21 (1,77–2,69) 7,19 (5,49–9,07)

D 6,58 (5,23–8,04) 1,88 (1,51–2,29) 5,08 (3,73–6,58)

E 5,60 (4,40–6,90) 2,06 (1,66–2,50) 4,48 (3,25–5,85)

Ж 6,07 (4,81–7,44) 1,87 (1,49–2,28) 6,70 (5,10–8,45)

G 5,35 (4,21–6,59) 1,76 (1,41–2,14) 4,74 (3,50–6,12)

H 6,05 (4,79–7,42) 2,05 (1,65–2,49) 5,01 (3,69–6,47)

I 6,00 (4,76–7,36) 1,79 (1,43–2,17) 7,03 (5,33–8,90)

Дж 5,50 (4,35–6,76) 2,09 (1,67–2,55) 3,05 (2,11–4,11)

Среднее значение6SD 5,8560,41 1,9660,16 5,45 61,34

Комбинированный 5,86 (5,46–6,28) 1,95 (1,83–2,08) 5,43 (4,97–5,91)

Частота мутаций по устойчивости к альфа-фактору, устойчивости к канаванину (CanR) и устойчивость к 5-фтороротовой кислоте (5-ФОР) для 10 клонов GIL104. В круглых скобках указаны 95% доверительные интервалы, рассчитанные с использованием формул. 29 и 30 из Фостера (2006). Комбинированный набор данных рассматривает 10 анализов флуктуации с 72 пробирками как одну 720 пробирку.

рассчитывается по одно- и двухпараметрической моделям. Пока используется большое количество культур, двойная разница между лучшими одно- и двухпараметрическими оценками ½L¼2 (log (P2 Param) log (P1 Param) распределяется

asx2с 1 ф.л. Это означает, что если лучший двухпараметрический оценка на 0,1,92 логарифмических единиц лучше, чем лучшая оценка с одним параметром; вероятность того, что модель с двумя параметрами лучше соответствует данным, составляет 0,95. Второй метод заключался в использовании AIC, который использует как логарифмическую вероятность, так и количество параметров при вычислении оценки, чтобы найти модель, которая наилучшим образом соответствует данным. Оба более подробно описаны в материалах и методах.

Для анализов флуктуации 13канаванина и тест логарифмического отношения правдоподобия, и AIC показывают, что данные лучше всего соответствуют двухпараметрической модели. Для анализов флуктуации 5-FOA нет улучшения соответствия с использованием двухпараметрической модели. Чтобы минимизировать постплатинговую мутацию, мы увеличили концентрацию канаванина в 10 раз и пересчитали чашки на 1 день раньше. Данные по 103 канаванину более точно соответствуют распределению Лурия – Дельбрюка (рис. 1). Хотя двухпараметрическая модель все же дает немного лучшее соответствие, согласно как тесту логарифмического отношения правдоподобия, так и AIC, данные лучше всего подходят однопараметрической модели. Для анализа флуктуации a-фактора данные лучше всего соответствуют двухпараметрической модели, однако обе модели не могут уловить все особенности этого распределения (рис. 1). Частота фенотипических мутаций: были проведены анализы флуктуаций для определения частоты мутаций до α-фактора, 103

резистентность к канаванину и 5-FOA для 10 изогенных клонов штамма из фона W303 (GIL104) данные были проанализированы с использованием однопараметрической и двухпараметрической моделей (таблицы 2 и 3, соответственно). Для каждого анализа применялись тест логарифмического отношения правдоподобия и AIC, чтобы определить, какая модель лучше всего соответствует данным.

(Таблица 3). Все анализы флуктуаций a-фактора лучше всего описываются двухпараметрической моделью, тогда как все анализы флуктуаций 5-FOA лучше всего описываются распределением Луриа-Дельбрюка (однопараметрическая модель). Для канаванина 103 пять анализов флуктуации в соответствии с тестом логарифмического отношения правдоподобия или шесть в соответствии с AIC лучше всего подходят для двухпараметрической модели.

Используя объединенные данные по 10 клонам (эффективно флуктуационный анализ с 720 параллельными культурами) и двухпараметрическую модель, мы определили, что частота фенотипических мутаций к α-фактору, 103 канаванину и устойчивости к 5-FOA составляет 3,073 · 106., 1.52 3 107, и 5,43 3 108, соответственно. Для сопротивления 5-FOA данные лучше всего описывается однопараметрической моделью (d¼0 для двухпараметрической модели, что означает, что постплантационный рост и мутация не происходит), поэтому мы можем использовать уравнения 29 и 30 из Foster (2006), чтобы присвоить 95% доверительный интервал нашей оценке. скорости мутации. Это дает доверительный интервал 4,97–5,913 · 108.на поколения (таблица 2). Для двухпараметрической модели доверительные интервалы определены путем моделирования. Для каждого комбинированного анализа флуктуаций с 720 культурами мы определили наиболее вероятные значения formandd с учетом данных. Чтобы оценить ожидаемые вариации этих параметров, мы смоделировали 1000 анализов флуктуаций путем выборки комбинированного распределения Луриа – Дельбрюка / Пуассона с использованием параметров, определенных на основе данных. Мы принимаем 95% доверительный интервал для нашей оценки m как значения m, которые охватывают 95% смоделированных экспериментов. Исходя из этого, мы вычисляем 95% доверительный интервал для двухпараметрической модели, равный 2,65–3,623 · 106., 1.34– 1.71 3 107, и 4,78–5,87 3 108 для а-фактор, 103 канаванин и устойчивость к 5-FOA соответственно.

Спектры мутаций и размер мишени: Спектры мутаций: мы хотели преобразовать нашу частоту фенотипических мутаций в Рис. 1. - Результаты для трех 72-пробирок.

анализ флуктуаций с использованием клона A GIL104, нанесенного на 13канаванин, 5-FOA, 103

канаванин и а-фактор. Сплошные кружки показывают кумулятивное распределение данных. Сплошные кривые показывают кумулятивные распределения Луриа – Дельбрюка (однопараметрическая модель), соответствующие данным с параметром m¼4,80, 1,31, 2,82 и 1,97 для 13 канаванина, 5-FOA, 103 канаванина и a-фактора. , соответственно. Жирная заштрихованная кривая представляет собой двухпараметрическую модель роста после посадки, согласованную с данными с m 2,31, d¼ 2,62m¼ 2,39, d¼0,37 и mÀ1,10 и dÀ1,42 для 13канаванина и 103канаванина, соответственно. Однопараметрическая и двухпараметрическая модели одинаковы для 5-FOA. Используя информационный критерий Акаике (Akaike 1974),

частота мутаций на пару оснований. Материалом для этой конверсии являются мутационные спектры из анализов флуктуаций, которые мы секвенировали 237ura3alleles и 227can1alleles из 5-FOA- и 103 канаванин-устойчивых штаммов соответственно (идентичность всех 464 мутантных аллелей доступна в дополнительных информация на http://www.genetics.org/supplemental/). Тридцать устойчивых к 5-FOA мутантов содержат аллели URA3 дикого типа. 29 из этих мутантов являются прототрофами урацила. Сообщалось, что мутации в FUR1 могут давать этот фенотип, однако нам не удалось найти никаких мутаций в кодирующей последовательности этого гена ни для одного из 29 5-FOA-устойчивых прототрофов урацила (данные не показаны). Ни один из 207 мутантов ura3 не является прототрофным, и каждый содержит одну или две мутации в пределах нескольких нуклеотидов. Имеются замены 167 пар оснований (64 бессмысленных и 103 неправильных), 22 делеции одиночных пар оснований, 3 делеции 2 пар оснований, 3 вставки одиночных пар оснований, одна вставка 3 пар оснований, две большие тандемные дупликации и девять двойных мутаций (рис. 2). Все 227 103 устойчивых к канаванину мутантов содержат единственную мутацию или близко расположенные мутации в локусе CAN1. Мы обнаружили замены 150 п.н. (70 бессмысленных и 80 ошибочных), 55 делеций одиночных п.н., 8 вставок одиночных п.н., одну вставку 2 п.н., 10 двойных мутаций и 3 комплексные мутации, включая acan1allele, содержащий делецию 27 п.н. тандемная дупликация длиной 30 п.н. (рис. 3).

Частота бессмысленных мутаций на пару оснований: исходя из полученных на данный момент результатов, мы можем рассчитать частоту бессмысленных мутаций на пару оснований в генах CAN1 иURA3. Сначала нам нужно скорректировать частоту фенотипических мутаций до устойчивости к 5-FOA, чтобы учесть, что только 207 из

237 мутантов 5-FOA являются мутантами URA3. Это приводит к частоте мутаций для потери функции 4,753 · 108.для URA3и 1,523 107дляCAN1. Если мы умножим эти На долю нонсенс-мутаций в мутационных спектрах мы находим, что частота нонсенс-мутаций atURA3 и CAN1 составляет 1,473 · 108и 4,693 108, соответственно. ДляURA3а такжеCAN1, мы посчитали количество возможных бессмысленных замен из известных последовательностей этих генов. URA3 составляет 804 п.н., следовательно, существует 2412 возможных замен (804 п.н. 33 возможных замены на пару оснований). Из них 123 приводят к бессмысленным мутациям. Разделив эти скорости на количество возможных бессмысленных замен и умножение на 3, поскольку существует 3 возможных мутации на каждом основании, мы обнаруживаем, что нормализованная частота бессмысленных мутаций на пару оснований составляет 3,583 · 10 · 10дляURA3и 6.213 1010дляCAN1. Повторение приведенного выше анализа для всех 10 При анализе флуктуаций CAN1 иURA3 из таблицы 3 мы обнаруживаем, что частота нонсенс-мутаций на пару оснований значительно различается в этих двух локусах (сумма рангов Вилкоксона, P, 1,833 · 104). Эти расчеты были выполнены со скоростями мутаций из двухпараметрической модели с поправкой на постплантационный рост и мутации на чашках с кана-ванином. Если бы мы использовали однопараметрическую модель, разница в частоте мутаций между URA3 и CAN1 была бы больше, поскольку однопараметрическая модель переоценивает частоту фенотипических мутаций устойчивости к канаванину.

Определение эффективного размера мишени: мы определяем размер мишени для выполнения двух расчетов: определения скорости геномной мутации с учетом экспериментов, которые измеряют скорость мутации в конкретном локусе, и прогнозирования скорости.


1. ВВЕДЕНИЕ

Понимание генетических основ таких процессов, как адаптация и видообразование, является основной целью эволюционной биологии. Это требует количественной оценки количества задействованных локусов и их распределения в геноме (например, геномной архитектуры), а также типа мутации и связанных с ними статистических свойств. В последнее время основное внимание уделяется типам мутаций (например, SNP, транслокации, инверсии), и в литературе изобилуют подробные обсуждения эволюционного значения различных типов мутаций (например, Choi & Lee, 2020 Faria et al., 2019 Katju & Бергторссон, 2013). Однако в большинстве этих обзоров, а также в большинстве теоретических и эмпирических исследований не исследуется весь спектр типов мутаций. Чтобы понять относительное эволюционное значение различных типов мутаций, мы должны рассматривать их одновременно в единой структуре.

С эволюционной точки зрения наиболее важными характеристиками мутации являются частота ее возникновения, популяционно-генетические эффекты и то, как они могут влиять на последующие эволюционные результаты. Здесь мы предлагаем структуру исследования, которая использует преимущества десятилетий популяционно-генетических исследований (Charlesworth & Charlesworth, 2010 Futuyma, 1986), чтобы напрямую использовать популяционные генетические эффекты различных типов мутаций для определения их относительной эволюционной значимости (Рисунок 1a). Мы рассматриваем популяционные генетические эффекты как влияние мутации на популяционные генетические параметры: скорость рекомбинации, эффективный размер популяции, коэффициенты отбора и доминирования (см. Рисунок 1c для обзора популяционных генетических эффектов каждого типа мутации). Хотя другие характеристики, например, влияет ли мутация на регуляторные или кодирующие области, также важны для эволюции (Hoekstra & Coyne, 2007), мы сосредоточимся здесь на характеристиках, которые могут быть напрямую связаны с типом мутации.

Наша концепция сочетает в себе то, что мы называем «прямым» и «обратным» подходами. Начиная с мутации, прямой подход характеризует, как часто встречаются разные типы мутаций (рис. 1b), и их популяционно-генетические эффекты (рис. 1c), чтобы предсказать их роль в различных эволюционных исходах. Обратный подход начинается с эволюционного результата и, используя эмпирические данные, систематически определяет относительный вклад нескольких типов мутаций. Уже имеется обширный объем знаний о популяционных генетических эффектах различных мутаций (например, о прямом подходе Dobigny et al., 2017 Elena et al., 1998 Korunes & Noor, 2019 Malik, 2009). Напротив, в нескольких исследованиях одновременно изучаются несколько типов мутаций с использованием обратного подхода. Таким образом, здесь мы делаем упор на опережающий подход.

Чтобы обрисовать перспективный подход, мы даем неисчерпывающий обзор того, что известно о частоте мутаций и популяционно-генетических эффектах различных мутаций, используя преимущества обширного существующего объема работ (Choi & Lee, 2020 Faria et al., 2019 Katju И Бергторссон, 2013). Мы подчеркиваем, что количественная оценка этих эффектов, оценка различий между типами мутаций и определение распределения размеров эффектов будет важным шагом вперед, и предлагаем различные способы достижения этого. Мы обсуждаем области, в которых необходимы дополнительные эмпирические данные, теория и синтез для прямого подхода, и подчеркиваем важность применения обратного подхода.

1.1 Скорость мутации

Скорость мутации является критическим параметром при исследовании эволюционного воздействия различных типов мутаций. Его можно измерить напрямую, сравнив количество мутаций в гаметах, зиготах или потомстве (Fu & Huai, 2003). Для SNP это также можно измерить косвенно, сравнивая данные синонимичного (обычно предполагаемого нейтрального) полиморфизма внутри и между близкородственными видами. Оценки скорости мутаций сильно различаются в зависимости от таксонов и типов мутаций (рис. 1b). Однако разные мутации различаются в отношении их обнаруживаемости (например, SNP с гораздо большей вероятностью будут обнаружены с помощью данных секвенирования с коротким считыванием, чем с более крупными вставками или делециями [Ho et al., 2020]), что может привести к недооценке частота мутаций различных мутаций. Новые методики могут помочь решить эту проблему. В частности, данные длительного считывания в сочетании с другими методологиями, такими как секвенирование связанного считывания (Seo et al., 2016) и методами захвата и секвенирования хроматина, такими как Hi-C (Wang et al., 2020), могут облегчить идентификацию больших структурных вариантов. (Рождество и др., 2019). Таким образом, двумя ключевыми шагами, определенными нашей структурой, являются (i) дальнейшая разработка новых методов, позволяющих одновременно обнаруживать различные типы мутаций, и (ii) увеличение как количества, так и таксономической широты исследований, которые напрямую оценивают частоту мутаций и проанализировать несколько различных типов мутаций в одном таксоне.


В чем разница между мутацией на пару оснований и мутацией на геном? - Биология

Пониманием сходства и различий между людьми занимаются психологи, антропологи, художники, врачи и, конечно же, многие биологи. Даже если рассматривать только генетические различия между людьми, остается множество вопросов для обсуждения. День, когда ДНК, извлеченная на месте преступления, может привести к портрету из кружки, кажется, уже наступил, по крайней мере, согласно недавней публикации о моделировании трехмерной формы лица из ДНК (П. Клас и другие, PLOS Genetics, 10: e1004224, 2014). В духе клеточной биологии с помощью чисел, можем ли мы получить некоторую основную интуицию, логически проанализировав значение нескольких ключевых чисел, которые имеют отношение к вопросу генетического разнообразия у людей.

Мы начнем с сосредоточения внимания на различиях одной пары оснований или полиморфизмах (SNP). Другие компоненты вариации, такие как вставки и делеции, различное количество повторов генов (часть того, что известно как вариации числа копий или CNV) и мобильные элементы, будут затронуты ниже. Сколько вариаций одной пары оснований вы ожидаете между вами и случайно выбранным человеком на углу улицы? Усилия по секвенированию, такие как проект «1000 геномов», дают нам практическое правило. Они находят примерно один SNP на 1000 баз. То есть, если оставить в стороне другие компоненты, это является основанием для утверждения, что люди на 99,9% генетически похожи. Но это генетическое сходство вызывает вопрос: почему мы чувствуем себя такими разными от человека, с которым сталкиваемся на улице? Что ж, продолжайте читать, чтобы узнать о других генетических различиях, но нужно также понимать, как наш мозг настроен, чтобы замечать и усиливать различия и распределять объединяющие свойства, такие как у всех нас две руки, один нос, большой мозг и т. Д. . Для инопланетянина мы, вероятно, все будем выглядеть одинаково, точно так же, как вы можете увидеть двух мышей, и если у них одинаковая шуба, они будут казаться клонами, даже если один из них Ричард Фейнман из его клана, а другой - Уинстон Черчилль.

Вернемся к цифрам. Давайте проверим точность и значение эмпирического правила: один SNP на 1000 баз. Геном человека имеет длину около 3 Гбит / с. Это предполагает около 3 миллионов SNP среди двух случайных людей. Это действительно заявленное значение с точностью до 10%, что неудивительно, так как это источник практического правила (BNID 110117).Что еще можно сказать об этом номере? Имея около 20000 генов, каждый из которых имеет кодирующую последовательность (экзоны) длиной около 1,5 т.п.н. (т.е. в среднем белок длиной около 500 аминокислот), кодирующая последовательность человека покрывает 30 МБп или около 1% генома. Если SNP были распределены по геному случайным образом, это будет предполагать около 30 000 SNP в кодирующей последовательности генома или чуть более 1 на кодирующую последовательность гена. Измеренное значение составляет около 20 000 SNP, что дает представление о том, насколько мы ошибались в нашем предположении, что SNP распределены случайным образом. Таким образом, мы статистически ошибаемся, поскольку любой статистический тест дал бы впечатляюще низкую вероятность того, что это более низкое значение появится случайно. Вероятно, это показатель более сильного очищающего отбора по кодирующим областям. В то же время, для наших практических терминов это менее чем двукратная вариация предполагает, что это смещение не очень сильное и что 1 SNP на ген является разумным практическим правилом.

Как такое распределение SNP трансформируется в изменения аминокислот в белках? Давайте снова предположим гомогенное распределение среди мутаций, изменяющих аминокислоту (несинонимичные), и тех, которые не влияют на идентичность аминокислот (синонимы). Исходя из генетического кода, количество несинонимичных изменений при отсутствии отбора или смещения любого рода должно примерно в четыре раза превышать количество синонимичных мутаций (т. Е. Синонимичные мутации составляют около 20% возможных мутаций, BNID 111167). Это потому, что существует больше замен оснований, которые изменяют аминокислоту, чем тех, которые сохраняют идентичность аминокислот той же самой. Что находишь на самом деле? Фактически обнаружено около 10 000 мутаций каждого типа (BNID 110117), что показывает, что действительно существует предвзятость в сторону недопредставления несинонимичных мутаций, но в нашем мировоззрении по порядку величины она не является серьезной.

Один тип мутации, который может быть особенно важным, - это бессмысленная мутация, которая создает стоп-кодон, который преждевременно прерывает трансляцию. Как часто мы можем наивно ожидать обнаружения таких мутаций, учитывая общую нагрузку SNP? Три из 64 кодонов являются стоп-кодонами, поэтому мы грубо ожидаем 20 000 * 3/64 ≈ 1000 мутаций ранней остановки. Наблюдения показывают около 100 таких бессмысленных мутаций, что указывает на сильную избирательную предвзятость в отношении таких мутаций. Тем не менее, нам интересно посмотреть на человека рядом с нами и подумать, какие 100 белков в наших геномах усечены по-разному. Из-за диплоидной природы наших геномов обычно существует другая полностью неповрежденная копия гена (такая ситуация известна как гетерозиготность), которая может служить резервной копией.

Насколько ваш генотип отличается от генотипа каждого из ваших родителей? Если предположить, что у них нет родственных генотипов, указанные выше значения следует сократить вдвое, так как вы разделяете половину геномов отца и матери. Так что еще довольно много усеченных генов и замененных аминокислот. Ситуация с вашим братом или сестрой количественно аналогична, поскольку вы снова в среднем разделяете половину своих геномов (при условии, что вы не однояйцевые близнецы…). Фактически, примерно на 1/4 вашего генома вы и ваш брат или сестра похожи на однояйцевых близнецов, то есть у вас есть две одинаковые родительские копии ДНК. Вставки и делеции (так называемые инделы) примерно до 100 оснований подсчитать сложнее, но наблюдается порядка 1 миллиона на геном, примерно 3000 из них в кодирующих областях (так что недопредставленность составляет примерно полпорядка). Более крупные вариации более длинных отрезков, включая вариации числа копий, составляют десятки тысяч на геном, но поскольку они такие длинные, их суммарная длина может быть больше, чем количество оснований в SNP.

Способность всесторонне охарактеризовать эти вариации - очень недавнее научное достижение, начавшееся только в третьем тысячелетии с незабываемой гонки между консорциумом проекта генома человека и группой, возглавляемой Крейгом Вентером. Сравнивая результаты этих двух команд, можно обнаружить, что при сравнении генома Крейга Вентера с геномом согласованной эталонной последовательности генома человека разница составляет около 1,2% при рассмотрении индексов и CNV и 0,1% при рассмотрении SNP: ≈ 0,3% с учетом инверсий - всего 1,6% (BNID 110248). В течение десятилетия, которое последовало за секвенированием генома человека, технологии развивались чрезвычайно быстро, что привело к проекту «1000 геномов», который некоторым нашим читателям может показаться проектом ротации к тому времени, когда они прочитают эти слова. Кто знает, как скоро читатель сможет действительно проверить наши цитируемые числа, загрузив свой геном из своего медицинского отчета и сравнив его со случайным другом.


Заключение

Мутационная селекция уже давно является полезным инструментом не только в арсенале селекционера, но и в арсенале генетика. В культурах, где разнообразие по данному признаку низкое или отсутствует, индуцированный мутагенез открывает новые возможности. Имея четкую цель, эффективный протокол мутагенности, а также высокопроизводительный и эффективный метод фенотипического скрининга, мутагенез может иметь большое значение для улучшения сельскохозяйственных культур.


В чем разница между мутацией на пару оснований и мутацией на геном? - Биология

Митохондрии - это «квоторганеллы» в живых клетках, которые отвечают за выработку энергии, называемой АТФ (аденозинтрифосфат), которая необходима всем клеткам для функционирования. Митохондрии несут свою собственную отдельную ДНК (мтДНК), которая не зависит от ядерной ДНК той же клетки. МтДНК человека состоит из 37 генов, составляющих около 16 000 пар оснований. Эта мтДНК также мутирует с гораздо большей скоростью, чем ядерная ДНК (нукДНК). МтДНК человека полностью картирована, и все кодирующие области известны (а также белки или РНК, для которых они кодируются). Некоторые из мтДНК ничего не кодирует (считается, что эти участки защищены от «естественного давления отбора») и известны как «контролируемые области». Кажется, что одна конкретная область мутирует быстрее, чем любая другая (в 1,8 раза быстрее), потому что здесь наибольшие различия между людьми. 4 Когда клетка делится, каждая клетка забирает с собой часть митохондрий. Митохондрии независимо реплицируются внутри клетки. Помимо этого, обычно считалось, что митохондрии всегда передаются от матери к потомству без участия в генетической перетасовке и рекомбинации мтДНК с мтДНК отца. Однако в последнее время это понятие подверглось сомнению. Как оказалось, многие случаи отцовской мтДНК были обнаружены в современных семьях людей, а также у других видов. Рассмотрим результаты интересного исследования, опубликованного Шварцем и Виссингом в выпуске журнала 2002 г. Медицинский журнал Новой Англии:

«Считается, что митохондриальная ДНК (мтДНК) млекопитающих передается строго по материнской линии. Митохондрии сперматозоидов исчезают в раннем эмбриогенезе путем избирательного разрушения, инактивации или простого разбавления огромным избытком митохондрий ооцитов. . . Основной механизм, ответственный за элиминацию мтДНК сперматозоидов у нормальных эмбрионов, не совсем понятен. Мы предполагаем, что в некоторых случаях этот процесс может быть дефектным, что позволяет митохондриям сперматозоидов выжить и дает тем, у кого есть избирательное преимущество, возможность преобладания в определенных тканях. . . Очень небольшое количество наследуемой от отца мтДНК было обнаружено с помощью полимеразной цепной реакции (ПЦР) у мышей после нескольких поколений межвидовых обратных скрещиваний. Исследования таких гибридов и ооцитов мышей с микроинъекцией спермой подтверждают гипотезу о том, что митохондрии сперматозоидов нацелены на разрушение ядерно-кодируемыми белками. Мы сообщаем о случае 28-летнего мужчины с митохондриальной миопатией из-за новой делеции мтДНК длиной 2 п.н. ND2 ген (также известный как MTND2), который кодирует субъединицу ферментного комплекса I дыхательной цепи митохондрий. Мы определили, что мтДНК, несущая мутацию, имела отцовское происхождение и составляла 90 процентов мтДНК мышц пациента ». 47

Итак, что такое открытие означает в отношении частоты мутаций мтДНК и молекулярных часов? Что ж, рассмотрим следующие комментарии Морриса и Лайтаулерса, опубликованные в выпуске 2000 года. Ланцет:

Считается, что митохондриальная ДНК (мтДНК) наследуется исключительно от матери. Однако в нескольких недавних работах было высказано предположение, что элементы мтДНК иногда могут быть унаследованы от отца. Эта гипотеза основана на доказательствах того, что мтДНК может подвергаться рекомбинации. Если это действительно происходит, материнская мтДНК в яйце должна перекрещиваться с гомологичными последовательностями в другой молекуле ДНК. Отцовская мтДНК кажется наиболее вероятным кандидатом. Если мтДНК может рекомбинировать, независимо от механизма, это имеет важные последствия для эволюции мтДНК и для филогенетических исследований, в которых используется мтДНК. 48

До того, как были обнаружены эти доказательства отцовского наследования, предполагалось, что мтДНК была строго результатом материнского наследования. Основываясь на этом предположении, предполагалось, что митохондриальное потомство получит точные копии митохондрий, которые были у матери, за исключением случаев, когда произошла мутационная ошибка. Долгое время считалось, что эта частота ошибок в некодирующей части митохондриальной ДНК возникает каждые 300-600 поколений или каждые 6000-12000 лет для человека.

Биохимики из Беркли, разработавшие теорию, Аллан Уилсон, Ребекка Канн и Марк Стоункинг, сделали несколько очевидно разумных предположений. Поскольку не было изменений ДНК из-за событий генетической рекомбинации (то есть с отцовской ДНК - теперь известно, что это неправильное предположение), они предположили, что все изменения в мтДНК были результатом мутаций с течением времени и что эти мутации происходили постоянно. темп. На основании этих предположений исследователи полагали, что у них есть доступ к чему-то вроде «молекулярных часов». Поскольку считается, что мтДНК мутирует быстрее, чем ядерная ДНК (нуклеДНК), считалось, что более высокая скорость мутации мтДНК будет способствовать более точной хронометраж, чем nucDNA.

Первоначальное исследование 1987 года включало мтДНК 136 женщин из многих частей мира, имеющих различное расовое происхождение. Анализ, казалось, поддержал идею единственной предковой молекулы мтДНК от женщины, жившей в Африке к югу от Сахары около 200000 лет назад. Позже более подробные исследования, похоже, подтвердили этот вывод. К сожалению, как в компьютерной программе, так и в самих исследователях была необнаруженная предвзятость. Исследователи использовали компьютерную программу, предназначенную для выявления филогенеза «максимальной экономии» или генеалогического древа с наименьшим количеством мутационных изменений. Это было основано на предположении, что эволюция пошла бы наиболее прямым и эффективным путем (что не обязательно верно или даже вероятно). Кроме того, компьютерная программа была предвзята по порядку ввода данных в пользу информации, введенной первой. Эта проблема была обнаружена, когда компьютер выдал разные результаты в зависимости от порядка ввода данных. Теперь, после тысяч запусков компьютеров со случайным вводом данных, выясняется, что «африканское происхождение» современного человека не имеет статистической значимости по сравнению с другими возможными вариантами. 26

Проблемы с этими исследованиями были настолько серьезными, что Генри Джи, член редакции журнала, Природа, резко охарактеризовал исследования как «мусор». Рассмотрев количество задействованных последовательностей (136 последовательностей мтДНК), Джи подсчитал, что общее количество потенциально правильных экономных деревьев где-то превышает один миллиард. 25 Генетик Алан Темплтон (Вашингтонский университет) предполагает, что низкоуровневое смешение среди ранних человеческих популяций могло настолько зашифровать последовательности ДНК, что вопрос о происхождении современных людей и дате «Евы» никогда не мог быть решен с помощью мтДНК. 22 В письме к НаукаМарк Стоункинг (один из первых исследователей) признал, что теория «африканской Евы» была опровергнута. 23

Другой интересный аспект теории «молекулярных часов» - это способ определения самой скорости мутации. Вопреки тому, что многие могли подумать, частота мутаций изначально определялась не каким-либо прямым анализом, а предполагаемыми филогенными эволюционными отношениями между людьми и шимпанзе. Другими словами, частота мутаций была рассчитана на основе предположения, что рассматриваемая теория уже верна. Это довольно замкнутое предположение, и поэтому все результаты, основанные на этом предположении, будут соответствовать этому предположению - как самоисполняющееся пророчество. Поскольку скорость была рассчитана на основе предыдущих предположений относительно времени эволюции, результаты автоматически «подтверждают» предыдущие предположения. Если кто-то действительно желает независимого подтверждения теории, тогда нельзя откалибровать подтверждающий тест с помощью теории или какой-либо части теории, которая проверяется. И все же это именно то, что сделали такие ученые, как Сарич, один из пионеров идеи молекулярных часов. Сарич начал с расчета частоты мутаций у различных видов ». чье расхождение можно надежно датировать по окаменелостям ''. Затем он применил эту калибровку к расколу шимпанзе и человека, датируя это разделение от пяти до семи миллионов лет назад. Используя калибровку мутаций Сарича, Уилсон и Канн применили их к своим исследованиям мтДНК, сравнив & quot. отношение дивергенции митохондриальной ДНК у людей к расхождению между людьми и шимпанзе »24. С помощью этого метода они подсчитали, что общий предок всех современных людей,« африканская Ева », жил около 200 000 лет назад.

Очевидно, что эти даты, рассчитанные на основе анализа мтДНК, должны соответствовать предполагаемой шкале эволюционного времени, поскольку расчет основан на этом предположении. Цикличность этого метода несовместима с хорошим научным методом и бесполезна с точки зрения независимой прогностической ценности. Теория «митохондриальных часов» была и остается в основном теорией внутри теории в том смысле, что она не имеет независимой предсказательной силы вне теории эволюции. Удивительно, что раньше ученые не заметили этот врожденный недостаток. Интересно, однако, что этот недостаток в рассуждениях не обнаруживался в течение многих лет и, возможно, оставался бы незамеченным гораздо дольше, если бы не был проведен более прямой анализ скорости мутаций.

В конце концов, ученые, изучающие исторические семьи и их генетическую историю, начали подвергать сомнению частоту мутаций, основанную на эволюционных филогенетических предположениях. Эти ученые были «ошеломлены», обнаружив, что частота мутаций на самом деле намного выше, чем считалось ранее. Фактически, он был примерно в 20 раз выше примерно на одну мутацию каждые 25-40 поколений (примерно от 500 до 800 лет для людей). Похоже, что в этой части контрольной области, которая имеет около 610 пар оснований, люди обычно отличаются друг от друга примерно на 18 мутаций. 3 С помощью простой математики следует, что у современных людей есть общий предок примерно на 300 поколений назад во времени. Если предположить, что типичное время генерации составляет около 20 лет, это поместит дату общего предка примерно на 6000 лет раньше настоящего. Но как такое могло быть ?! Томас Парсонс кажется таким же озадаченным. Рассмотрим его следующие комментарии, опубликованные в апреле 1997 года в журнале Природа Генетика:

«Частота и характер замен последовательностей в контрольной области (CR) митохондриальной ДНК (мтДНК) имеют центральное значение для исследований эволюции человека и судебно-медицинской проверки личности. Здесь мы сообщаем о прямом измерении скорости замещения между поколениями в CR человека. Мы сравнили последовательности ДНК двух гипервариабельных сегментов CR от близких родственников по материнской линии из 134 независимых линий мтДНК, охватывающих 327 поколений. Наблюдали десять замен, что дало эмпирическую частоту 1/33 поколений, или 2,5 / сайт / млн. Лет. Это примерно в двадцать раз выше оценок, полученных на основе филогенетического анализа. Это несоответствие не может быть объяснено просто заменами в горячих точках мутаций, предлагая дополнительные факторы, которые вызывают несоответствие между очень краткосрочными и долгосрочными кажущимися скоростями расхождения последовательностей. Данные также указывают на то, что чрезвычайно быстрая сегрегация вариантов последовательности CR между поколениями является обычным явлением у людей с очень маленьким узким местом в мтДНК. Эти результаты имеют значение для судебно-медицинских приложений и исследований эволюции человека.

Наблюдаемая скорость замещения, представленная здесь, очень высока по сравнению со скоростью, выведенной из эволюционных исследований. На основании филогенетических исследований был получен широкий диапазон частот замены CR, охватывающий примерно 0,025–0,26 / сайт / млн лет, включая доверительные интервалы. Исследование, дающее одну из наиболее быстрых оценок, показало, что скорость замещения гипервариабельных областей CR составляет 0,118 + - 0,031 / сайт / млн лет. Если предположить, что время генерации составляет 20 лет, это соответствует

1/600 поколений и возраст мтДНК MRCA 133000 лет назад. Таким образом, наше наблюдение скорости замещения, 2,5 / сайт / млн лет, примерно в 20 раз выше, чем можно было бы предсказать из филогенетического анализа. Использование нашей эмпирической скорости для калибровки молекулярных часов мтДНК приведет к тому, что возраст MRCA мтДНК составит всего лишь

6500 лет назад, что явно несовместимо с известным возрастом современного человека. Даже признавая, что MRCA мтДНК может быть моложе MRCA современного человека, остается неправдоподобным объяснить известное географическое распределение вариации последовательности мтДНК миграцией человека, которая произошла только в последний период.

Расчет производится следующим образом: Рассмотрим двух случайно выбранных людей. Предполагая, что все люди изначально имеют идентичную митохондриальную ДНК, через 33 поколения две такие случайные человеческие семьи, вероятно, будут отличаться двумя мутациями, поскольку будут две отдельные линии наследования и, вероятно, одна мутация вдоль каждой линии. После 66 поколений два случайно выбранных человека будут отличаться примерно четырьмя мутациями. Через 100 поколений они будут отличаться примерно шестью мутациями. Через 300 поколений они будут отличаться примерно на 18 мутаций, что примерно соответствует наблюдаемой величине.

Эти эксперименты весьма интересны эволюционистам, которые ранее подсчитали, что «митохондриальный канун» (митохондрии которого, как полагают, являются митохондриями-предками всех живых людей) жила от 100 000 до 200 000 лет назад в Африке. 1 Новые расчеты, основанные на вышеупомянутых экспериментах, сделали бы ее относительно молодой

6500 лет. Теперь предыдущее представление о том, что современные люди имеют возраст до 10 000 поколений, должно быть переоценено или, по крайней мере, основание мтДНК для этого предположения должно быть переоценено - и так оно и было. 2

Более поздние прямые исследования частоты мутаций мтДНК, похоже, также подтверждают более ранние выводы Парсонса и других. В статье 2001 г., опубликованной в Американский журнал генетики человека, Эвелин Хейер et. др., представили свои данные о частоте мутаций мтДНК в глубоко укоренившихся франко-канадских родословных.

Их выводы «подтверждают более ранние выводы о гораздо большей частоте мутаций в семьях, чем те, которые основаны на филогенетических сравнениях». . . Для последовательностей HVI мы получили 220 поколений или 6600 лет, а для последовательностей HVII 275 поколений или 8250 лет. Хотя каждое из этих значений связано с большой дисперсией, они оба указывают на

7000-8000 лет и, следовательно, до раннего неолита как время экспансии [в основном североевропейского происхождения]. . . Наша общая оценка частоты мутаций CR составляет 11,6 на сайт на миллион поколений. . . выше, но существенно не отличается от значения 6,3, о котором сообщалось в недавнем родословном исследовании сопоставимого размера. . . В другом исследовании (Soodyall et al. 1997) не было обнаружено мутаций в 108 передачах. С другой стороны, две замены наблюдались в 81 передаче Howell et al. (1996), а девять замен наблюдались в 327 передачах Parsons et al. (1997). Объединение всех этих данных (1729 передач) дает частоту мутаций 15,5 (Cl 10,3–22,1). Если принять во внимание только те, которые имеют глубоко укоренившиеся родословные (1321 передача) (Soodyall et al. 1997 Sigurdardottir et al. 2000, настоящее исследование), получаем значение 7,9. Последнее, избегая экспериментальных проблем с гетероплазмией, может обеспечить более реалистичное приближение к общей частоте мутаций ». 44

Также рассмотрим статью 2003 г., опубликованную в Анналы генетики человека Б. Бонне-Тамир и другие. где авторы представили свои результаты своего исследования «материнских и отцовских линий» в небольшой изолированной самаритянской общине. В этой статье они пришли к выводу:

«По сравнению с результатами, полученными другими по частоте мутаций мтДНК, наша оценка верхнего предела скорости мутации 1/61 мутации на поколение находится в хорошем соответствии с ранее опубликованными» 45 [по сравнению со скоростью, определенной Парсонсом 1/33 поколений, коэффициент 1/61 не более чем в два раза]

Еще одна интересная статья, опубликованная в сентябре 2000 г. в Журнале. Ученый Денвер и другие. тоже довольно интересно. Эти ученые сообщили о своей работе с частотой мутаций мтДНК у нематодных червей и обнаружили, что молекулярные часы этих червей на самом деле работают примерно так:В 100 раз быстрее чем считалось ранее"[курсив добавлен]. 46

«Экстраполировать результаты напрямую на людей невозможно, - говорят ученые. Но их результаты подтверждают недавние противоречивые исследования, предполагающие, что молекулярные часы человека также работают в 100 раз быстрее, чем обычно думают. Это может означать, что расхождения между шимпанзе и людьми, а также появление современного человека произошли гораздо позже, чем полагают в настоящее время, говорят ученые. «Наша работа, похоже, поддерживает человеческий анализ, который показал очень высокую оценку», - говорит Келли Томас из Университета Миссури. «Эта работа актуальна для людей», - говорит Дуг Тернбилл из Института генетики человека и Университета Ньюкасла, Великобритания. «Если скорость человеческих мутаций будет выше, чем предполагалось, это окажет большое влияние на изучение болезней человека и судебно-медицинскую экспертизу, а также на скорость эволюции людей». . . .

Скорость мутации мтДНК у людей обычно оценивается путем сравнения последовательностей ДНК людей и других животных. «Это своего рода анализ, который использовался для определения того, что африканское происхождение современного человека произошло около 200 000 лет назад», - говорит Томас. «Проблема этого подхода в том, что вы учитываете как скорость мутаций, так и эффекты естественного отбора», - говорит он. По словам Пола Шарпа из Института генетики Ноттингемского университета в Великобритании, этот метод также позволит пропустить множественные мутации в одном и том же участке мтДНК.

В более поздних исследованиях изучалась мтДНК людей, которые имеют дальние родственники, но имеют предков женского пола. Этот подход выявил более высокую частоту мутаций мтДНК. Но результаты не были приняты многими учеными. [курсив добавлен].

Знание точной скорости мутации у людей очень важно для судебной медицины и изучения генетических заболеваний, подчеркивает Тернбилл. Судебная идентификация часто основывается на сравнении образцов ДНК с образцами от предполагаемых родственников. По его словам, более быстрые человеческие молекулярные часы могут усложнить установление точных соотношений ''. 46

Очевидно, что эти показатели, основанные на более прямых наблюдениях, далеки от темпов, основанных на косвенных эволюционных предположениях. Это определенно немного "усложняет" ситуацию, не так ли? Разве не странно, что многие ученые до сих пор не хотят принимать эти результаты? Предвзятость как в пользу эволюции, так и миллионов лет предполагаемого времени расхождения между существами, такими как обезьяны и люди, настолько сильна, что изменить мнение тех, кто придерживается таких позиций, может быть практически невозможно.

Есть много других потенциальных проблем для филогении, которые полагаются на анализ последовательности мтДНК и частоту мутаций. Одна из проблем заключается в том, что мтДНК функционирует как единый генетический локус, во многом так же, как единственный ген в нуклеДНК. Исследования, которые работают с одним генетическим локусом, с большей вероятностью будут затронуты случайными генетическими изменениями, чем исследования, которые включают более одного локуса (чем больше, тем лучше). Следовательно, исследования одного локуса менее точны при характеристике популяции. Помимо этого, новые доказательства смешения отцовской мтДНК довольно проблематичны. 16

Кроме того, как вкратце обсуждалось выше, использование контрольных областей в качестве «молекулярных часов» может оказаться не таким действенным, как предполагалось ранее. Некоторые нуклеотидные области мутируют медленно, тогда как другие могут мутировать относительно быстро. 17 Эти мутационные «горячие точки» могут довольно быстро мутировать даже в течение одной жизни и интуитивно довольно часто встречаются у пожилых людей. 18 Конечно, такие «квотсоматические» мутации возникают в митохондриях различных тканей тела и, если они не затрагивают гамет, они не передаются следующему поколению. Однако они все равно повлияли бы на филогенетические интерпретации. Ученые пытались решить эти проблемы, но разные методы дали разные результаты. 19 Кроме того, как обсуждалось выше, прямые сравнения современных последовательностей с историческими последовательностями часто дают результаты, сильно отличающиеся от результатов, оцененных косвенными методами, основанными на сегодняшних различиях последовательностей. В качестве другого примера из другого вида прямые сравнения современных пингвинов с исторически секвенированными пингвинами показали, что частота мутаций их мтДНК в 2–7 раз выше, чем предполагалось ранее с помощью косвенных методов. 20 Некоторые из этих проблем фактически привели некоторых ученых к прекращению использования последовательностей контрольной области для реконструкции филогении человека. 21 год

Те ученые, которые продолжают пытаться пересмотреть гипотезу молекулярных часов, пытались замедлить ход часов, показывая, что некоторые регионы мтДНК мутируют намного медленнее, чем другие регионы. Проблема здесь в том, что такие регионы явно подвержены естественному отбору. Другими словами, они не являются функционально нейтральными в отношении давления отбора.

Например, эксперименты в реальном времени показали, что средняя частота мутаций митохондриального генома составляет около 6 x 10 -8 мутаций / сайт / митохондриальное поколение - в соответствии с различными оценками средней скорости бактериальных мутаций (сравните со скоростью яДНК 4,4 x 10 -8 мутаций / митохондрий). / сайт / человеческое поколение). При среднем времени генерации 45 дней это примерно 5 x 10 -6 мутаций на сайт в год и 5 мутаций на сайт в год.

Это примерно в два раза выше, чем у Парсонса, равного 2,5 / mut / сайт / myr, и примерно в 40-50 раз выше, чем у показателей, основанных на филогенетических сравнениях и эволюционных предположениях. И это средняя скорость всего митохондриального генома в 16 000 пнн. Можно было бы разумно подумать, что все аспекты гипервариабельных областей (HVI и HVII) будут иметь более высокую, чем в среднем, скорость мутаций, если они действительно нейтральны в отношении давления функционального отбора. Учитывая это, эти «медленно мутирующие сайты» со скоростью 0,065 мут / сайт / мир (Heyer et al, 2001), по-видимому, поддерживаются смещенным образом за счет естественного отбора.

Опять же, такие ненейтральные изменения не обязательно являются отражением времени, прошедшего с момента появления общего предка, а скорее отражением различных функциональных потребностей разных существ в различных средах.

Как и в случае частоты мутаций митохондриальной ДНК, частота мутаций ядерной ДНК часто рассчитывалась на основе эволюционных сценариев, а не прямых методов. С помощью таких методов средняя частота мутаций для эукариот в целом до недавнего времени (см. Дальнейшее обсуждение ниже) оценивалась примерно в 2,2 x 10 -9 мутаций на пару оснований в год. 29 При средней продолжительности генерации 20 лет для людей это составляет около 4,4 x 10 -8 мутаций на пару оснований на поколение. Поскольку большинство оценок размера диплоидного генома человека составляет около 6,3 миллиарда пар оснований, эта частота мутаций даст среднему ребенку около 277 мутационных отличий от его или ее родителей. Это звучит как довольно большое число, и на самом деле оно находится в верхней части спектра по сравнению с исследованиями, более конкретно посвященными частоте мутаций человека по сравнению с частотой мутаций эукариот в целом. Однако оригинальное исследование Нахмана и Кроуэлла, похоже, подтвердило эту оценку путем сравнения контрольных последовательностей у людей и шимпанзе. Используя эти сравнения последовательностей, «средняя частота мутаций была оценена как

2,5 · 10 -8 мутаций на нуклеотидный сайт или 175 мутаций на диплоидный геном на поколение »[на основе более высокой оценки диплоидного генома, составляющей 7 миллиардов пар оснований]. 30

Эти оценки частоты непрямых мутаций также казались разумными, учитывая, что они, по-видимому, соответствовали частоте ошибок репликации ДНК, которые происходят между образованием зиготы в одном поколении и образованием зиготы в следующем поколении. На иллюстрации 31 ниже обратите внимание, что от оплодотворения до образования первой функциональной гаметы женщины требуется около 23 митотических делений. С другой стороны, мужчины вносят в среднем в два раза больше мутаций зародышевой линии, чем женщины. 33 По крайней мере, отчасти причина в том, что стволовые клетки у мужчин продолжают делиться, поэтому чем старше мужчина становится до рождения детей, тем больше происходит митотических делений.

Теперь представьте, что каждая диплоидная оплодотворенная зигота содержит около 6 миллиардов пар оснований ДНК (

3 миллиарда от каждой гаметы / родителя, используя консервативное круглое число). 32 От деления клетки до деления клетки частота ошибок для ДНК-полимеразы в сочетании с другими ферментами репарации составляет около 1 ошибки на 1 миллиард скопированных пар оснований. 42 При такой скорости существует около 6 ошибок с каждым событием репликации диплоидных клеток. При среднем показателе у мужчин / женщин 29 митотических делений до образования следующего поколения, получается около 175 мутаций на поколение.

Конечно, это соответствует скорости мутаций, основанной на эволюционных сценариях. Однако по некоторым оценкам общая частота мутаций составляет всего 1 ошибку на 10 миллиардов скопированных пар оснований. 43 При такой скорости можно было бы ожидать около 0,6 ошибки с каждым событием репликации и только около 17 мутаций на человека на поколение. Так, может быть, происходит что-то еще, что также влияет на скорость мутации ядерной ДНК? Оказывается, ошибки репликации - не единственные источники мутаций ДНК. Повреждение ДНК может происходить и часто происходит спонтанно. Стабильность генома постоянно подвергается сомнению из-за разнообразных мутагенных факторов, которые включают ошибки во время репликации ДНК, факторы окружающей среды, такие как УФ-излучение, и эндогенные мутагены, такие как свободные радикалы кислорода, образующиеся во время окислительного метаболизма. Это повреждение также необходимо постоянно обнаруживать и устранять. Конечно, это исправление несовершенно и, следовательно, вероятно, вносит значительный вклад в фактическую частоту мутаций сверх того, что оценивается с помощью уже обсужденных косвенных методов.

С другой стороны, более прямые методы определения скорости ядерных мутаций у животных предполагают, что фактическая измеренная скорость часто немного отличается от скорости, предполагаемой эволюционными предположениями (как выше, так и ниже). Например, наблюдаемая частота мутаций для C. elegans оказался в десять раз выше оценок, основанных на косвенных методах и эволюционных предположениях. Рассмотрим следующий отрывок из Денвера. et. аль. опубликовано в Природа в 2004 г .:

«Альтернативные подходы к млекопитающим, основанные на филогенетических сравнениях псевдогенных локусов и четырехкратно вырожденных позиций кодонов, страдают от неопределенности фактического числа поколений, разделяющих сравниваемые виды, и невозможности исключить предубеждения, связанные с естественным отбором. Здесь мы обеспечиваем прямую и объективную оценку частоты ядерных мутаций и их молекулярного спектра с набором C. elegans линии накопления мутаций, которые показывают скорость мутаций примерно в десять раз выше, чем предыдущие косвенные оценки, и превышение количества вставок над делециями »(см. ссылку).

Недавно были также проведены некоторые прямые измерения частоты мутаций человека, которые не совсем соответствуют показателям, основанным на эволюционных предположениях. В одной статье, опубликованной в журнале Science, предпринята попытка прямого измерения скорости мутаций путем сравнения полных последовательностей генома двух потомков и их родителей. Они подсчитали, что у каждого потомка было только 70 новых мутаций с частотой мутаций 1,1 x 10 -8 на гаплоидный геном на поколение (Roach и другие. 2010: Ссылка). Теперь это значение для гаплоидного генома, что эквивалентно скорости

140 мутаций на диплоидный геном (то есть довольно близко к скорости, отмеченной выше для диплоидного генома

170 мутаций в поколении). Если это правда, то время расхождения людей и шимпанзе должно быть установлено на 9 млн лет, и многие исследования недавней эволюции человека могут отличаться по крайней мере в два раза.

Итак, в чем дело? Что ж, учитывая частоту мутаций 140 на человека на поколение и тот факт, что большинство функциональных мутаций вредны, как генофонд человека не дегенерирует с течением времени? Это могло бы быть признано серьезной загадкой, если бы не тот факт, что примерно до 2014 года большая часть генома человека долгое время считалась большинством ученых не имеющей существенной функциональной роли. Поэтому считалось, что он может выдерживать довольно большое количество мутаций без какого-либо значительного вредного воздействия на общую функцию организма. Количество этой нефункциональной ДНК было однажды оценено путем вычисления кодирующей части ДНК и вычитания ее из общей геномной недвижимости. Учитывая, что средняя кодирующая часть человеческого гена имеет размер около 1350 пар оснований (кодирует белок размером около 450 аминокислот) 38, все, что нужно сделать, - это умножить это число на общее количество генов, чтобы получить разумную оценку. от общего количества кодирующей генетической недвижимости - первоначально считалось, что это где-то между 2-5% генома.

Однако в течение некоторого времени существовали некоторые разногласия относительно общего количества генов в геноме человека. В течение многих лет считалось, что у людей есть от 70 000 до 140 000 генов. Однако ученые, работающие над проектом генома человека, сделали удивительное открытие. Когда они закончили черновой вариант проекта в феврале 2001 года, они подсчитали, что фактическое количество генов составляет от 30 000 до 40 000 генов. 39 Но год спустя, в феврале 2002 г., на ежегодном собрании Американской ассоциации содействия развитию науки (издатель Наука), один из докладчиков, Виктор Велкулеску, предположил, что реальное количество генов в геноме человека может быть ближе к 70 000 генов в конце концов. 40

Конечно, текущая оценка количества генов в геноме снова снижается до 20–30 000. Однако это число почти не имеет значения сейчас, когда обнаруживается, что участки ДНК, не кодирующие белок, такие как многие так называемые псевдогены и миро-РНК, обладают значительной функциональностью - наряду с другими обширными участками некодирующей ДНК. Фактически, в настоящее время предполагается, что значительная часть генома человека функционирует с оценками в пределах 16-20% (Kellis, 2014). Некоторые оценки были даже выше (см. Ссылку). Это увеличение известного количества функциональной недвижимости в геноме делает гораздо более вероятным, что случайная мутация действительно будет функционально значимой. Это может показаться довольно серьезной проблемой, учитывая, что частота мутаций составляет около 170 мутаций на человека в поколении. Однако по состоянию на 2012 год прямые измерения частоты мутаций нуклеДНК, основанные на анализе современных семейных линий, показывают, что фактическая частота мутаций нуклеДНК составляет около 70 точечных мутаций на человека на поколение (Peter D. Keightley, 2012), что составляет менее половины от предыдущие оценки. Хотя это действительно помогает кому-то с проблемой частоты пагубных мутаций, на самом деле это не решает проблему, учитывая гораздо более значительное увеличение количества известной генетической недвижимости, которая действительно функциональна в той или иной степени.

Общий предок людей и обезьян, «живущих с динозаврами»?

Интересно отметить, что эта пониженная частота мутаций нуклеиновой ДНК значительно изменяет основанные на ДНК "часы" настолько, насколько долго люди и обезьяны должны иметь общего предка - примерно с шести миллионов до примерно 40 миллионов лет назад. (Callaway, 2012). «У этих очень медленных часов общий предок обезьян и людей сосуществовал с последними динозаврами». Это проблема, которую Дэвид Райх (Департамент генетики Гарвардской медицинской школы) подчеркивает, отмечая:

Это становится очень действительно сложно. На самом деле, я бы сказал, что «очень сложно» - это немного преуменьшить, если у вас есть общий предок людей и обезьян, живший с динозаврами.

и генетическая деградация человечества

Те, кто первоначально изучали этот вопрос, предположили, что частота вредных мутаций (Ud) составляет от 1 до 3 на человека на поколение, при этом, по крайней мере, некоторые ученые (Nachmann and Crowell, 2000) отдают предпочтение по крайней мере 3 или более. 30 Конечно, реальная частота вредных мутаций, как кратко отмечено выше, вероятно, будет намного выше. В любом случае, даже с учетом этих первоначальных предположений (поскольку количество вредных мутаций превышает количество полезных мутаций как минимум на 1000 к 1) казалось, что накопление вредных мутаций в популяции может привести к исчезновению. 34,36

Нахманн и Кроуэлл подробно описывают эту запутанную ситуацию в следующем заключении из своей статьи о частоте мутаций у человека:

Высокая частота вредных мутаций у людей представляет собой парадокс. Если мутации взаимодействуют мультипликативно, генетическая нагрузка, связанная с таким высоким U [частота вредных мутаций], будет недопустимой для видов с низкой скоростью воспроизводства [таких как люди, обезьяны и т. Д.]. . .

Снижение приспособленности (т. Е. Генетической нагрузки) из-за вредных мутаций с мультипликативными эффектами дается 1 - e -U (Kimura and Moruyama 1966).Для U = 3 средняя приспособленность снижается до 0,05, иначе говоря, каждая самка должна произвести 40 потомков из двух, чтобы выжить и сохранить популяцию на постоянном уровне. Это предполагает, что вся смертность происходит из-за отбора, и поэтому фактическое количество потомства, необходимое для поддержания постоянного размера популяции, вероятно, выше.

Проблема может быть несколько смягчена мягким отбором или отбором на ранней стадии развития (например, внутриутробно). Однако многие мутации безусловно вредны, и маловероятно, чтобы репродуктивный потенциал в среднем у самок человека достигал 40 зигот. Эта проблема может быть преодолена, если большинство вредных мутаций проявляют синергетический эпистаз, то есть если каждая дополнительная мутация приводит к большему снижению относительной приспособленности. В крайнем случае, это приводит к усеченному отбору, при котором все особи, несущие больше порогового количества мутаций, исключаются из популяции. Хотя крайний отбор с усечением кажется нереалистичным [смерть всех тех, у кого есть пагубный мутационный баланс], представленные здесь результаты показывают, что вероятна некоторая форма положительного эпистаза среди вредных мутаций. 30

Нахманн и Кроуэлл сочли эту ситуацию очень загадочной. Как избавиться от всех плохих мутаций быстрее, чем они возникают? Они предложили несколько возможных решений, например концепцию, которую они назвали «положительный эпистаз». Однако, если бы функциональные эффекты мутаций были увеличены мультипликативно, а не аддитивно, решило бы это проблему? Как отмечалось выше, даже если каждая вредная мутация приводила к смерти ее владельца, репродуктивная нагрузка выживших не уменьшалась, а оставалась прежней.

Например, предположим, что все те, у кого есть по крайней мере три вредные мутации, умирают до размножения. Вскоре средний показатель популяции будет чуть выше 3-х вредных мутаций. Более 95% каждого последующего поколения будет иметь 3 или более вредных мутаций по сравнению с исходной «нейтральной» популяцией. Смертность резко возрастет. Чтобы не отставать, репродуктивная способность этих выживших особей должна увеличиваться пропорционально увеличению смертности. То же самое в конечном итоге произойдет, если линия смерти будет проведена на 100, 500, 1000, 10000 или более вредных мутациях. Единственное различие будет заключаться в продолжительности времени, которое потребуется данной популяции для накопления смертельного числа вредных мутаций в ее генофонде, начиная с относительно «нейтральной» начальной точки. Популяция может довольно хорошо выжить в течение многих поколений, не прибегая к огромному увеличению скорости воспроизводства. Однако, если не избавиться от накапливающихся вредных мутаций, популяция в конечном итоге обнаружит, что ее смертность экспоненциально возрастает, поскольку ее средняя популяция пересекает линию летальных мутаций.

Поскольку теория положительного эпистаза, похоже, не сильно помогает ситуации, необходимо найти какой-то другой процесс, чтобы объяснить, как предпочтительно избавиться от вредных мутаций в популяции. Рассмотрим отрывок из Scientific American опубликованная в 1999 г. статья под названием "Изобилие мутаций":

Согласно стандартной теории популяционной генетики, число трех вредных мутаций на человека в каждом поколении подразумевает, что три человека должны были бы преждевременно умереть в каждом поколении (или не смогли бы воспроизвести) для каждого человека, который размножался, чтобы устранить теперь отсутствующие вредные мутации [ 75% смертности]. Люди не размножаются достаточно быстро, чтобы выдержать такое огромное количество погибших. Как риторически спросил Джеймс Ф. Кроу из Университета Висконсина в комментарии на Природа по анализу Эйр-Уокера и Кейтли: "Почему мы не вымерли?"

Ответ Кроу состоит в том, что секс, который перемешивает гены, позволяет уничтожать пагубные мутации группами. Таким образом, новые результаты подтверждают идею о том, что пол возник потому, что люди, унаследовавшие (благодаря сексу) несколько плохих мутаций, избавляют генофонд от них всех сразу, не сумев выжить или воспроизвести.

Однако с появлением современной медицины естественный отбор в человеческих популяциях ослаб, отмечает Кроу. Таким образом, он предполагает, что вредные мутации теперь могут начать накапливаться с еще большей скоростью, что может иметь тревожные последствия для здоровья. Кейтли настроен скептически: он считает, что многие умеренно вредоносные мутации уже получили широкое распространение в человеческих популяциях в результате случайных событий в эволюции, и что различные адаптации, особенно интеллект, более чем компенсируются. «Я сомневаюсь, что нам придется заплатить штраф, как, кажется, думает Ворона», - замечает он. "До сих пор мы прекрасно справлялись. & quot 37

Возможно, тогда ответ можно будет найти в сочетании процессов, в которых и половая репликация, и естественный отбор играют роль в предотвращении вымирания медленно воспроизводящейся популяции. Например, рассмотрим следующую диаграмму, показывающую, как вредные мутации накапливаются в популяции, которая размножается бесполым путем: 49

Обратите внимание на то, как наиболее подходящие числа потерь «класса родителя» (P) в каждом поколении, в то время как число тех, у кого больше вредных мутаций, растет все больше и больше. В этой статье Райс отмечает, что в бесполых популяциях единственный способ по-настоящему преодолеть накопление вредных мутаций - это существенно увеличить скорость воспроизводства. Но как насчет полезных мутаций? Райс комментирует: «Редкие обратные и компенсаторные мутации могут перемещать вредные мутации через генетический автостоп против потока генетической поляризации. Но это незначительное влияние, аналогичное водной турбулентности, которая иногда переносит гальку на небольшое расстояние вверх по течению »49. Итак, как популяции, размножающиеся половым путем, могут преодолеть эту проблему?

Что касается популяций, воспроизводящихся половым путем, способность к генетической рекомбинации во время образования гамет позволяет концентрировать как хорошие, так и плохие мутации. Например, предположим, что у нас есть два человека, каждый с двумя вредными мутациями. Учитывая сексуальную рекомбинацию между этими двумя людьми, есть приличный шанс, что у некоторых из их потомков (1 шанс из 32) не будет никаких унаследованных вредных мутаций. Но что происходит, когда частота дополнительных вредных мутаций достаточно высока? - скажем, 3 человека на поколение?

Чтобы немного разобраться в этом, рассмотрим еще один пример устойчивой популяции из 5000 особей, каждая из которых начинается с 7 вредных мутаций и средней частотой вредных мутаций 3 на человека на поколение. Учитывая коэффициент воспроизводства 4 потомков на каждую из 2500 пар (10 000 потомков), в одном поколении, у скольких потомков будут такие же или меньше вредных мутаций, чем у родительского поколения?


Клональный отбор как альтернативный механизм генерации множественных мутаций

Гипотеза о том, что прогрессирование опухоли включает последовательные волны клональной селекции, была первоначально выдвинута Ноуэллом (2). Согласно этой гипотезе, каждая выбранная мутация дает пролиферативное преимущество, приводя к последовательным клональным линиям. Появление последовательных хромосомных изменений было продемонстрировано при злокачественной меланоме (39) и наиболее широко при аденокарциноме толстой кишки (40). Проблема с идеей последовательных мутаций с последующим строгим отбором заключается в том, что каждая мутация должна давать большое селективное преимущество, даже если рецессивные мутации происходят только в одном из двух аллелей. Хотя для генеза рака толстой кишки человека была предложена последовательная модель накопления мутаций (40), было показано, что только небольшая часть опухолей (6,6%) содержит три наиболее часто определяемые мутации (41). Эти результаты предполагают, что множественные мутации в дополнение к обычно обнаруживаемым могут быть вовлечены в образование рака толстой кишки.

Фенотип мутатора и отбор мутаций в специфических онкогенах и генах-супрессорах опухолей на самом деле не являются взаимоисключающими концепциями, в настоящее время широко признано, что мутации могут происходить случайным образом, и могут быть отобраны мутации, которые управляют клональной пролиферацией. Более того, эти процессы могут быть взаимозависимыми. Последовательные раунды отбора мутаций, усиливающих пролиферацию Кишечная палочка в результате образуется популяция клеток, экспрессирующих мутаторный фенотип (42). В каждом раунде отбора различных полезных мутаций происходит одновременный отбор мутаций в генах, которые вызывают мутации в этих генах (т.е. мутантные мутанты). Подобный «автостоп» мутаторных генов во время последовательных раундов отбора также был продемонстрирован на дрожжах (Р. Колоднер, личное сообщение) и может быть применим к росту опухолей, где отбор проводится для мутантов, которые демонстрируют преимущество роста в различных условиях. Ханахан и Вайнберг (43) в ходе всестороннего анализа определили шесть существенных изменений в физиологии клеток, которые управляют злокачественным ростом, каждое из этих изменений может потребовать мутаций, которые обеспечивают преимущество селективного роста и могут одновременно обогащать мутаторные аллели. Таким образом, как клональный отбор, так и создание мутантных мутантов могут действовать во время прогрессирования опухоли, и преобладающий путь может быть различным в разных опухолях.


Варианты доступа

Получите полный доступ к журналу на 1 год

Все цены являются ценами НЕТТО.
НДС будет добавлен позже при оформлении заказа.
Расчет налога будет завершен во время оформления заказа.

Получите ограниченный по времени или полный доступ к статье на ReadCube.

Все цены являются ценами НЕТТО.


Материалы и методы

Бактериальные штаммы и среды.

Штамм PFM2 дикого типа является прототрофным производным Кишечная палочка Эталонный штамм К12 MG1655 (73, 74). Штамм MutL PFM5 является производным от PFM2 с mutL ген заменен последовательностью рубца в рамке считывания (75). Подробная информация об используемых генетических методах и средах приведена в SI Материалы и методы.

Оценка скорости мутаций с помощью флуктуационных тестов.

Скорость мутации в Nal R или Rif R оценивалась с использованием тестов флуктуации, как описано (76). Более подробная информация представлена ​​в SI Материалы и методы.

MA Процедура.

Линии МА происходили из отдельных колоний, выделенных на чашках с агаром LB, каждый день. Каждую линию наносили штрихами на отдельные колонии на чашке с агаром LB, по две линии на чашку, и инкубировали при 37 ° C в течение 24 часов. Чтобы избежать предвзятости, колония, выбранная для пассажа, была хорошо изолированной, ближайшей к линии, проведенной по центру чашки. Первоначально были начаты 100 линий штамма дикого типа и 70 линий штамма MutL, но потери произошли во время пассажа (когда не была получена одна колония), подготовки ДНК, конструирования библиотеки и из-за неоднозначности клонов (см. Общий анализ мутаций ниже). На каждый из этих шагов приходилось снижение примерно на 20%, в результате чего количество строк указано в таблице 1. Потери были случайными и не должны влиять на результаты. Ни в коем случае линия не была потеряна из-за того, что вымерла. Более подробная информация представлена ​​в SI Материалы и методы.

Оценка поколений и жизнеспособности клеток в колониях.

Число поколений на пассаж, рассчитанное по количеству клеток в колониях данного диаметра, обычно составляло 28 поколений. Доля мертвых клеток в ресуспендированных колониях, определенная с помощью набора Live / Dead BacLight Bacterial Viability Kit (Invitrogen, Inc), составляла 0,05 ± 0,01 (среднее ± SEM). Более подробная информация представлена ​​в SI Материалы и методы.

Получение геномной ДНК.

Набор для очистки геномной ДНК PureLink (Invitrogen Corp.) использовали для очистки геномной ДНК из 0,5–1 мл ночных культур LB, инокулированных из запасов морозильника. Концентрацию и чистоту ДНК оценивали с помощью спектрофотометра NanoDrop ND-1000 (Thermo Fisher Scientific, Inc.).

Секвенирование и контроль качества.

Секвенирование было выполнено в Пекинском институте генома (BGI) с использованием платформы Illumina HiSeq2000. Для каждой линии MA сохранялось ~ 101 (470 Мбит / с) считывание парных концов (2 × 90 пар оснований) после отбрасывания считываний, которые не соответствовали контролю качества BGI. Чтения с любой из следующих характеристик были отброшены: (я) ≥10% нечитаемых баз (ii) ≥20% низкого качества (≤Q20) базы (iii) контаминация адаптера (перекрытие ≥15 п.н., допускающее несоответствие до 3 п.н.) или (iv) повторяющиеся пары чтения. После такой фильтрации в среднем сохранялось 91,1% прочтений.

SNP и короткие независимые вызовы.

Эталонной последовательностью генома была эталонная последовательность NCBI NC_000913.2. Для каждого образца показания Illumina были выровнены по Кишечная палочка Геном K12 (штамм MG1655) с помощью инструмента выравнивания по короткому чтению, BWA (ver. 0.5.9) (77). Короткие вставки (≤4 п.н.) были вызваны на основе отображения чтения процедур вызова SNP. Более подробная информация представлена ​​в SI Материалы и методы.

Подтверждение мутации обычным секвенированием.

Мы случайным образом выбрали 19 BPS из линий 3K MA дикого типа (~ 20% от общего числа) для подтверждения. Поскольку инделы обычно сложнее точно определить, чем SNP (78), мы проверили все 10 маленьких инделей, вызванных из линии 3K MA дикого типа. В наборе данных BPS не было ложных вызовов. Один indel, который назывался -G, на самом деле был удалением 24 nt в повторяющемся элементе, все остальные вызовы indel были правильными. Более подробная информация представлена ​​в SI Материалы и методы.

Аннотация мутации.

Было написано несколько пользовательских сценариев для аннотирования возможных вариантов. Координаты генов, кодирующих белок, были получены со страницы GenBank эталонной последовательности NCBI NC_000913.2. На основании генетического кода BPS были определены как синонимичные, несинонимичные или некодирующие. Несинонимичные BPS были определены как консервативные или неконсервативные на основе матрицы BLOSUM62 (79), значение ≥0 считалось консервативным.

Общий анализ мутаций.

Штаммы дикого типа и MutL - испытали ~ 80 и

75 поколений роста, соответственно, по мере проверки их фенотипов, а также по мере замораживания и повторного выращивания до первого узкого места для протокола МА. Таким образом, линии МА могли иметь общие мутации, произошедшие в этот период. Выравнивание последовательностей и анализ клонов использовались, чтобы отличить мутации, возникшие независимо от мутаций, имеющих общего предка. Более подробная информация представлена ​​в SI Материалы и методы.

Моделирование Монте-Карло.

Был написан специальный сценарий для моделирования случайного распределения BPS, соответствующего наблюдаемым мутационным спектрам. Для простоты количество мутаций было зафиксировано на наблюдаемом уровне. Было смоделировано 1000 испытаний.