Информация

Общие сведения об адаптерах Illumina

Общие сведения об адаптерах Illumina


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

В настоящее время я работаю над проектом, в котором мне нужно отрезать адаптеры от некоторых односторонних считываемых данных RNA-Seq, и я хочу знать, какие последовательности нужно расщеплять. Использовались адаптеры Illumina TruSeq. Я попытался последовать объяснениям Тафта и разобраться в видео Illumina, но у меня осталось несколько нерешенных вопросов.

Универсальный адаптер TruSeq, кажется, является тем, что связывается с проточной ячейкой и

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

Индекс адаптера TruSeq N равен

GATCGGAAGAGCACACGTCTGAACTCCAGTCAC-NNNNNN-ATCTCGTATGCCGTCTTCTGCTTG

Мое впечатление о том, как фрагмент кДНК прикреплен к адаптерам:

(проточная ячейка) || || || (Индексный адаптер) (Универсальный адаптер) || 3 '5' 3 '5' || GTTCGTCTTCTGCCGTATGCTCTA-NNNNNN-CACTGACCTCAAGTCTGCACACGAGAAGGCTAGA TCTAGCCTTCTCGCAGCACATCCCTTTCTCACATCTAGAGCCACCAGCGGCATAGTAA || |||||||||||||| |||||||||||||| <----- Необходимо денатурировать! || 5 'AATGATCGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT - (5' ФРАГМЕНТ МОЕЙ ДНК 3 ') - AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ‐ NNNNNN ‐ ATCTCGTATGCCGTCTGCCT ||TGCCT ||TGCCT ||TGCCT ||TGCCT || || ^ (Олиго проточной кюветы) ^ (Универсальный адаптер) ^ (Индексный адаптер) || || TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGTG || || ^ (Прочитать 1 учебник) ^ (Прочитать 2 учебника) || || || TAGAGCATACGGCAGAAGACGAAC ---------- || || || ^ (Олиго проточной кюветы) ||

Вот мои вопросы:

  1. Правильно ли это изображение в одножильном корпусе?

  2. Есть ли у меня правильный сайт связывания праймера (используемый для фактического секвенирования)?

  3. Есть ли у меня правильный олиго для парных конечных чтений, т.е.TAGAGCATACGGCAGAAGACGAAC ---------?

  4. Есть ли у меня правильный учебник (и его сайт) для чтения индекса?

Per Illumina, полагаю, мне нужно включить следующее: «Олигонуклеотидные последовательности © 2007-2013 Illumina, Inc. Все права защищены. Производные работы, созданные клиентами Illumina, разрешены для использования только с инструментами и продуктами Illumina. Любое другое использование строго запрещено. "


Секвенирование красителей Illumina

Платформа секвенирования Illumina (ранее известная как Solexa) основана на методе «циклического обратимого завершения», описанном в Bentley et al. (2008). Библиотеки ДНК, полученные путем случайной фрагментации и связанные с адаптерами, иммобилизуются на твердой поверхности, называемой «проточной ячейкой». Проточные ячейки состоят из восьми каналов или дорожек, которые плотно покрыты «лужайкой» ковалентно связанных праймеров, комплементарных 5'- и 3'-адаптерам. Каждая дорожка может быть загружена отдельной библиотекой, состоящей из одного образца или, что чаще всего для бактерий, мультиплексированных библиотек, содержащих до 96 библиотек с индексными тегами. Фрагменты ДНК связываются с праймерами на проточной кювете, где они амплифицируются. на месте в процессе твердофазной ПЦР, также известной как мостиковая амплификация, которая создает идентичные копии каждой отдельной молекулы-шаблона в непосредственной близости (кластеры). Этот процесс может производить до 10 миллионов кластеров на основе одной молекулы в каждом канале проточной ячейки (Mardis, 2008 Shendure & amp Ji, 2008), все из которых затем секвенируются одновременно.

Во время каждого цикла секвенирования к цепи нуклеиновой кислоты добавляется один меченый дезоксинуклеозидтрифосфат (dNTP). Нуклеотид также служит терминатором для полимеризации, поэтому после каждого раунда включения dNTP флуоресцентный краситель визуализируется для идентификации основания, а затем расщепляется вместе с модификацией терминации, чтобы позволить включение следующего нуклеотида (Bentley et al., 2008) . Поскольку все четыре дНТФ, связанные с обратимым терминатором (A, C, T, G), присутствуют в виде отдельных отдельных молекул, естественная конкуренция снижает шансы включения одного нуклеотида в большей степени, чем других. Базовые вызовы выполняются непосредственно из измерений интенсивности сигнала во время каждого цикла. После каждого цикла ярлыки удаляются, что позволяет перейти на следующий уровень включения (Turcatti, Romieu, Fedurco, & amp Tairi, 2008). Секвенирование Illumina стало наиболее коммерчески успешной платформой (Metzker, 2010 Shendure et al., 2011), производя считывания до 125 п.н. на машинах Hiseq с использованием химии SBS v4 или 300 п.н. на Miseq, в зависимости от количества циклы. Частота ошибок замены обычно составляет около 1% или ниже, с небольшим количеством ложных отступов.

Мультиплексирование 96 образцов на дорожку или 768 образцов на проточную ячейку привело к увеличению пропускной способности для бактериальных последовательностей. Методы подготовки библиотеки могут быть изменены для выполнения секвенирования по парным концам, то есть создания последовательностей, считываемых с обоих концов фрагментов матричной ДНК с использованием двух наборов праймеров для секвенирования (Roach, Boysen, Wang, & amp Hood, 1995). Illumina Hiseq 2500 генерирует до 1000 ГБ баз за один прогон с максимальным числом считываний 4000 M и максимальной длиной считывания 2 × 125 битов. Miseq, прибор с меньшей пропускной способностью и более быстрым оборотом, предназначенный для небольших лабораторий и клинической диагностики, также был выпущен в 2011 году. Miseq имеет максимальный выход 15 Гб, число считываний 25 M и длину считывания до 2 × 300 бит / с. В 2014 году Illumina выпустила Nextseq 500, настольный секвенсор с возможностями Hiseq или Miseq. Nextseq 500 в настоящее время способен обеспечить общий объем выходных данных до 120 Гбайт, число операций чтения 400 Мбайт и чтение 2 × 150 бит / с (http://www.illumina.com/systems.ilmn).


Секвенирование ДНК

Технология секвенирования следующего поколения (NGS) компании Illumina использует клональную амплификацию и химию секвенирования путем синтеза (SBS) для обеспечения быстрого и точного секвенирования. Процесс одновременно идентифицирует основания ДНК и включает их в цепь нуклеиновой кислоты. Каждое основание излучает уникальный флуоресцентный сигнал при добавлении к растущей цепи, который используется для определения порядка последовательности ДНК.

Технология NGS может использоваться для секвенирования ДНК любого организма, обеспечивая ценную информацию в ответ практически на любой биологический вопрос. Высоко масштабируемая технология, секвенирование ДНК может применяться к небольшим целевым областям или ко всему геному с помощью различных методов, что позволяет исследователям исследовать и лучше понимать здоровье и болезни.

Одно десятилетие секвенирования

Узнайте о достижениях, достижениях и прогрессе.

Преимущества секвенирования ДНК с помощью NGS

  • Последовательность больших участков ДНК в массовом параллельном режиме, предлагая преимущества в производительности и масштабе по сравнению с секвенированием по Сэнгеру на основе капиллярного электрофореза
  • Обеспечивает высокое разрешение для получения пошагового обзора гена, экзома или генома
  • Обеспечивает количественные измерения на основе интенсивности сигнала
  • Обнаруживает практически все типы изменений геномной ДНК, включая варианты одиночных нуклеотидов, вставки и делеции, изменения числа копий и хромосомные аберрации
  • Обеспечивает высокую производительность и гибкость для масштабирования исследований и секвенирования нескольких образцов одновременно
Настольные секвенаторы ДНК

Сравните скорость и производительность систем секвенирования ДНК Illumina, чтобы найти лучший вариант для своей лаборатории.

Общие методы секвенирования ДНК

Секвенирование всего генома

Полногеномное секвенирование - наиболее полный метод анализа генома. Быстрое снижение затрат на секвенирование и возможность получить ценную информацию обо всем генетическом коде делают этот метод мощным инструментом исследования.

Целевое изменение последовательности

При целевом пересеквенировании выделяется и секвенируется подмножество генов или областей генома, что позволяет исследователям сосредоточить время, расходы и анализ на конкретных областях, представляющих интерес.

Чип-секвенирование

Комбинируя анализы иммунопреципитации хроматина (ChIP) и секвенирование, ChIP-секвенирование (ChIP-Seq) является мощным методом идентификации сайтов связывания ДНК по всему геному для факторов транскрипции и других белков.

Подготовка библиотеки для секвенирования ДНК

Наше универсальное портфолио для подготовки библиотек позволяет исследовать небольшие целевые области или весь геном. Мы внедрили инновации в технологии без ПЦР и фрагментации на гранулах, предлагая экономию времени, гибкость и повышенную производительность секвенирования данных.

Обзор методов секвенирования ДНК

Этот сборник рецензируемых публикаций содержит плюсы и минусы, схематические диаграммы протоколов и соответствующие ссылки на различные методы секвенирования ДНК.

Связанные решения

Секвенирование раковой ДНК

Методы секвенирования на основе NGS позволяют исследователям рака обнаруживать редкие соматические варианты, сравнивать опухоль с нормальным состоянием и анализировать циркулирующие фрагменты ДНК. Узнайте больше о секвенировании рака.

Решения для генотипирования

Технологии генотипирования на основе секвенирования и массивов могут дать представление о функциональных последствиях генетической изменчивости. Узнайте больше о генотипировании.

Технология бесклеточной ДНК

Бесклеточная ДНК (вкДНК) - это короткие фрагменты ДНК, попадающие в кровоток. вкДНК из образца материнской крови можно использовать для скрининга общих хромосомных состояний у плода. Узнайте больше о технологии бесклеточной ДНК.

Микробное секвенирование

Анализ видов микробов с использованием секвенирования ДНК может дать информацию для исследований метагеномики окружающей среды, эпиднадзора за инфекционными заболеваниями, молекулярной эпидемиологии и т. Д. Узнайте больше о методах микробиологического секвенирования.

Заинтересованы в получении информационных бюллетеней, тематических исследований и информации о методах геномного анализа? Введите ваш адрес электронной почты.

Дополнительные ресурсы

Технология NGS

NGS превратилась в повседневный исследовательский инструмент, используемый для решения сложных современных биологических вопросов.

Панель генов и поиск массивов

Определите панели секвенирования или микрочипы, нацеленные на интересующие вас гены.

Анализ данных секвенирования ДНК

Найдите интуитивно понятные инструменты анализа, которые преобразуют необработанные данные секвенирования ДНК в значимые результаты.

Советы по поиску и устранению неисправностей

Эти короткие видеоролики содержат советы экспертов по таким вопросам, как чрезмерная кластеризация, непоследовательное количественное определение и определение последовательности во вставке.

Руководство по методам

Вся необходимая информация, от чипов BeadChips до подготовки библиотеки и выбора секвенатора и анализа. Выберите лучшие инструменты для своей лаборатории.

Найдите правильный комплект

Определите лучший комплект или набор для подготовки библиотеки для ваших нужд на основе вашего исходного материала и интересующего метода.

Инновационные технологии

В Illumina наша цель - применять инновационные технологии для анализа генетических вариаций и функций, делая возможными исследования, о которых еще несколько лет назад было невозможно даже вообразить. Для нас критически важно предоставлять инновационные, гибкие и масштабируемые решения для удовлетворения потребностей наших клиентов. Как глобальная компания, которая придает большое значение совместному взаимодействию, быстрой доставке решений и обеспечению высочайшего уровня качества, мы стремимся решить эту задачу. Инновационные технологии секвенирования и массивов Illumina способствуют революционным достижениям в области биологических исследований, трансляционной и потребительской геномики и молекулярной диагностики.

Только для исследовательского использования. Не для использования в диагностических процедурах (за исключением особо оговоренных случаев).


Общие сведения об адаптерах Illumina - биология

Конвейеры генерации файлов Illumina FASTQ включают опцию обрезки адаптера для удаления последовательностей адаптеров с 3'-концов чтения. Последовательности адаптеров должны быть удалены из считываний, поскольку они мешают последующему анализу, например выравниванию считываний по ссылке. Адаптеры содержат сайты связывания праймеров секвенирования, индексные последовательности и сайты, которые позволяют фрагментам библиотеки прикрепляться к лужайке проточных кювет. Библиотеки, подготовленные с помощью комплектов для подготовки библиотек Illumina, требуют обрезки адаптера только на 3 ’концах считывания, поскольку последовательности адаптеров не обнаруживаются на 5’ концах.

Примечание: Библиотеки, подготовленные с помощью комплекта для подготовки библиотек Nextera ™ Mate Pair, являются исключением, и рекомендации по обрезке адаптеров из этих библиотек можно найти в технической заметке «Обработка данных Nextera Mate Pair Reads на платформах секвенирования Illumina».

Чтобы понять, почему последовательности адаптеров обнаруживаются только на 3 ’концах считываний, сначала нужно понять, где праймеры для секвенирования отжигаются с шаблоном библиотеки на проточной кювете. На диаграммах ниже показаны участки отжига праймеров на каждом этапе цикла секвенирования: считывание 1, индекс 1, индекс 2 и считывание 2.

Рис. 1. Реагенты MiSeq ™, HiSeq ™ 1000/1500/2000/2500 и NovaSeq ™ 6000 v1.0, проточная кювета с парными концами.

Рис. 2. iSeq ™ 100, MiniSeq ™, NextSeq ™ 500/550, NextSeq 1000/2000, HiSeq 3000/4000 проточная кювета с парным концом и реагенты NovaSeq 6000 v1.5.

Как показано на рисунках 1 и 2, как при считывании 1, так и при считывании 2 праймер для секвенирования отжигается с адаптером, непосредственно перед вставкой ДНК (серым цветом). Поскольку секвенирование начинается с первого основания вставки ДНК в считываниях 1 и 2, адаптер не секвенируется в начале считывания. Однако, если секвенирование выходит за пределы длины вставки ДНК и распространяется на адаптер на противоположном конце фрагмента библиотеки, эта последовательность адаптера будет обнаружена на 3 ’конце считываемого фрагмента. Следовательно, считывания требуют обрезки адаптера только на их 3-х дюймовых концах.


Нанести ответный удар

Illumina, похоже, меняет положение перед лицом растущей конкуренции. Чтобы решить проблемы, связанные с ценой, Illumina инвестировала в новые инновации, снижающие затраты, и поставляет новую линейку секвенаторов, ориентированную на 600 долларов за геном, с планом по достижению 100 долларов за геном. В дорожной карте также содержится призыв к увеличению инвестиций в искусственный интеллект (ИИ) и поддержку передовых технологий «multi-omics», в которых используется расширенное определение последовательности для создания более полного понимания биологии, лежащей в основе здоровья и болезней человека.

Обновленный подход, похоже, приносит свои плоды. Во время телефонной конференции Illumina в первом квартале генеральный директор Фрэнсис де Суза сообщил, что заказы достигли рекордно высокого уровня, и компания также добилась прогресса в выходе на новые рынки и получении компенсации за геномное лечение. В 2021 финансовом году Illumina ожидает годового роста выручки в диапазоне от 25% до 28%, при этом прибыль по GAAP на разводненную акцию составит от 4,72 до 4,97 долларов США, а прибыль без учета GAAP на разводненную акцию - от 5,80 до 6,05 долларов США.


Секвенирование ДНК

Технология секвенирования следующего поколения (NGS) компании Illumina использует клональную амплификацию и химию секвенирования путем синтеза (SBS) для обеспечения быстрого и точного секвенирования. Процесс одновременно идентифицирует основания ДНК и включает их в цепь нуклеиновой кислоты. Каждое основание излучает уникальный флуоресцентный сигнал при добавлении к растущей цепи, который используется для определения порядка последовательности ДНК.

Технология NGS может использоваться для секвенирования ДНК любого организма, предоставляя ценную информацию в ответ практически на любой биологический вопрос. Высоко масштабируемая технология, секвенирование ДНК может применяться к небольшим целевым областям или ко всему геному с помощью различных методов, что позволяет исследователям исследовать и лучше понимать здоровье и болезни.

Одно десятилетие секвенирования

Узнавайте о достижениях, достижениях и прогрессе.

Преимущества секвенирования ДНК с помощью NGS

  • Последовательность больших участков ДНК в массовом параллельном режиме, предлагая преимущества в производительности и масштабе по сравнению с секвенированием по Сэнгеру на основе капиллярного электрофореза
  • Обеспечивает высокое разрешение для получения пошагового обзора гена, экзома или генома
  • Обеспечивает количественные измерения на основе интенсивности сигнала
  • Обнаруживает практически все типы изменений геномной ДНК, включая варианты одиночных нуклеотидов, вставки и делеции, изменения числа копий и хромосомные аберрации
  • Обеспечивает высокую производительность и гибкость для масштабирования исследований и секвенирования нескольких образцов одновременно
Настольные секвенаторы ДНК

Сравните скорость и производительность систем секвенирования ДНК Illumina, чтобы найти лучший вариант для своей лаборатории.

Общие методы секвенирования ДНК

Секвенирование всего генома

Полногеномное секвенирование - наиболее полный метод анализа генома. Быстрое снижение затрат на секвенирование и возможность получить ценную информацию обо всем генетическом коде делают этот метод мощным инструментом исследования.

Целевое изменение последовательности

При целевом пересеквенировании выделяется и секвенируется подмножество генов или участков генома, что позволяет исследователям сосредоточить время, расходы и анализ на конкретных областях, представляющих интерес.

Чип-секвенирование

Комбинируя анализы иммунопреципитации хроматина (ChIP) и секвенирование, ChIP-секвенирование (ChIP-Seq) является мощным методом идентификации сайтов связывания ДНК по всему геному для факторов транскрипции и других белков.

Подготовка библиотеки для секвенирования ДНК

Наше универсальное портфолио для подготовки библиотек позволяет исследовать небольшие целевые области или весь геном. Мы внедрили инновации в технологии фрагментации без ПЦР и фрагментации на гранулах, предлагая экономию времени, гибкость и повышенную производительность секвенирования данных.

Обзор методов секвенирования ДНК

Этот сборник рецензируемых публикаций содержит плюсы и минусы, схематические диаграммы протоколов и соответствующие ссылки на различные методы секвенирования ДНК.

Связанные решения

Секвенирование раковой ДНК

Методы секвенирования на основе NGS позволяют исследователям рака обнаруживать редкие соматические варианты, сравнивать опухоль с нормальным состоянием и анализировать циркулирующие фрагменты ДНК. Узнайте больше о секвенировании рака.

Решения для генотипирования

Технологии генотипирования на основе секвенирования и массивов могут дать представление о функциональных последствиях генетической изменчивости. Узнайте больше о генотипировании.

Обнаружение причинного варианта

Технологии высокопроизводительного секвенирования ДНК позволяют исследователям быстро проверять большое количество образцов для поиска причинных вариантов, связанных со сложными заболеваниями. Узнайте больше об обнаружении причинных вариантов.

Микробное секвенирование

Анализ видов микробов с использованием секвенирования ДНК может дать информацию для исследований метагеномики окружающей среды, эпиднадзора за инфекционными заболеваниями, молекулярной эпидемиологии и т. Д. Узнайте больше о методах микробного секвенирования.

Заинтересованы в получении информационных бюллетеней, тематических исследований и информации о методах геномного анализа? Введите ваш адрес электронной почты.

Дополнительные ресурсы

Технология NGS

NGS превратилась в повседневный исследовательский инструмент, используемый для решения сложных современных биологических вопросов.

Анализ данных секвенирования ДНК

Найдите интуитивно понятные инструменты анализа, которые преобразуют необработанные данные секвенирования ДНК в значимые результаты.

Советы по поиску и устранению неисправностей

Эти короткие видеоролики содержат советы экспертов по таким вопросам, как чрезмерная кластеризация, несогласованное количественное определение и определение последовательности во вставке.

Добейтесь успеха с помощью нескольких методов

Посетите наш информационный центр, чтобы узнать, как сочетание секвенирования ДНК с другими геномными методами может привести к прорыву.

Инновационные технологии

В Illumina наша цель - применять инновационные технологии для анализа генетических вариаций и функций, делая возможными исследования, о которых еще несколько лет назад было невозможно даже вообразить. Для нас критически важно предоставлять инновационные, гибкие и масштабируемые решения для удовлетворения потребностей наших клиентов. Как глобальная компания, которая придает большое значение совместному взаимодействию, быстрой доставке решений и обеспечению высочайшего уровня качества, мы стремимся решить эту задачу. Инновационные технологии секвенирования и массивов Illumina способствуют революционным достижениям в области биологических исследований, трансляционной и потребительской геномики и молекулярной диагностики.


Общие сведения об адаптерах Illumina - биология

Технология секвенирования Illumina использует создание кластеров и химию секвенирования путем синтеза (SBS) для секвенирования миллионов или миллиардов кластеров на проточной кювете, в зависимости от платформы секвенирования. Во время химического анализа SBS для каждого кластера выполняются базовые вызовы и сохраняются для каждого цикла секвенирования с помощью программного обеспечения анализа в реальном времени (RTA) на приборе. RTA хранит данные о базовом вызове в виде файлов индивидуального базового вызова (или BCL). По завершении секвенирования вызовы базы в файлах BCL должны быть преобразованы в данные последовательности. Этот процесс называется преобразованием BCL в FASTQ.

Файл FASTQ - это текстовый файл, содержащий данные последовательности из кластеров, которые проходят фильтр на проточной ячейке (дополнительную информацию о кластерах, прошедших фильтр, см. В разделе «Дополнительная информация» этого бюллетеня). Если образцы были мультиплексированы, первым шагом в создании файла FASTQ является демультиплексирование. При демультиплексировании кластеры назначаются выборке на основе последовательностей индексов кластера. После демультиплексирования собранные последовательности записываются в файлы FASTQ для каждого образца. Если образцы не были мультиплексированы, этап демультиплексирования не выполняется, и для каждой полосы проточной кюветы все кластеры назначаются одному образцу.

При однократном считывании создается один файл FASTQ для чтения 1 (R1) для каждого образца на полосу проточной кюветы. Для прогона с парным концом для каждого образца для каждой дорожки создается один файл R1 и один файл FASTQ для чтения 2 (R2). Файлы FASTQ сжимаются и создаются с расширением * .fastq.gz.

Как выглядит файл FASTQ?

Для каждого кластера, прошедшего фильтр, отдельная последовательность записывается в файл FASTQ R1 соответствующей выборки, а для прогона с парным концом отдельная последовательность также записывается в файл FASTQ образца R2. Каждая запись в файлах FASTQ состоит из 4 строк:

  1. Идентификатор последовательности с информацией о цикле секвенирования и кластере. Точное содержание этой строки зависит от используемого программного обеспечения преобразования BCL в FASTQ.
  2. Последовательность (база называет A, C, T, G и N).
  3. Разделитель, который представляет собой просто знак плюса (+).
  4. Базовые оценки качества связи. Они закодированы в формате Phred +33 с использованием символов ASCII для представления числовых показателей качества.

Вот пример одной записи в файле R1 FASTQ:

Более подробную информацию о формате файла последовательности FASTQ можно найти здесь.

Как просмотреть файл FASTQ

Файлы FASTQ могут содержать до миллионов записей и могут иметь размер в несколько мегабайт или гигабайт, что часто делает их слишком большими для открытия в обычном текстовом редакторе. Как правило, нет необходимости просматривать файлы FASTQ, поскольку они представляют собой промежуточные выходные файлы, используемые в качестве входных для инструментов, выполняющих последующий анализ, например выравнивание по ссылке или сборке de novo.

Если вам нужно просмотреть файл FASTQ для устранения неполадок или из любопытства, вам понадобится либо текстовый редактор, который может обрабатывать очень большие файлы, либо доступ к системе Unix или Linux, где большие файлы можно просматривать через командную строку.

Как сгенерировать файлы FASTQ

Создание файла FASTQ - это первый шаг для всех рабочих процессов анализа, используемых MiSeq Reporter в MiSeq и Local Run Manager в MiniSeq. По завершении анализа файлы FASTQ будут размещены в & ltrun folder & gt Data Intensities BaseCalls в MiSeq и в папке & ltoutput & gt Alignment _ # & ltsubfolder & gt Fastq в MiniSeq.

Для всех прогонов, загруженных в BaseSpace Sequence Hub, создание файла FASTQ автоматически происходит после полной загрузки цикла, а файлы FASTQ используются в качестве входных данных для различных аналитических приложений в BaseSpace Sequence Hub. В BaseSpace Sequence Hub вы можете найти свои файлы FASTQ в проектах, связанных с вашим запуском.

Программное обеспечение для преобразования bcl2fastq можно использовать для создания файлов FASTQ из данных, созданных на всех существующих системах секвенирования Illumina.

Информацию о различных настройках, которые можно применить во время создания файла FASTQ, см. В руководствах пользователя программного обеспечения ниже.


Общие сведения об адаптерах Illumina - биология

Наборы Illumina Enrichment (на основе ДНК и РНК) помогают изолировать и обогащать определенные интересующие области в геноме или транскриптоме для секвенирования. Например, программа Illumina DNA Prep with Enrichment (ранее известная как Nextera Flex для обогащения) с панелью TruSight Cancer Panel нацелена на 94 гена и 284 SNP, которые связаны с различными видами рака.

В этом бюллетене описаны принципы реакции обогащения и общепринятая терминология при описании комплектов обогащения Illumina.

В наборах для обогащения «Реакция» (сокращенно «rxn») относится к количеству реакций обогащения, которые предоставляются с набором. «Сплетение» (сокращенно «сплетение») относится к количеству предварительно обогащенных библиотек, которые объединяются вместе в реакции обогащения. Например, в наборе 8-rxn x 12-plex достаточно реагентов для выполнения восьми обогащений. В каждой реакции обогащения можно объединить 12 библиотек. Таким образом, общее количество образцов, которые можно приготовить с помощью этого набора, составляет 96 образцов. На следующем рисунке показано, как три библиотеки объединяются в одну реакцию обогащения.

На этой иллюстрации готовят три предварительно обогащенные библиотеки, затем объединяют вместе в равных количествах (по массе) для гибридизации с целевыми зондами обогащения (объединение 3-сплетений). Эти связанные с зондом фрагменты затем захватываются гранулами стрептавидина. Любые несвязанные фрагменты смываются, а связанные фрагменты, обогащенные интересующими последовательностями, будут элюированы с гранул стрептавидина и секвенированы.

Наборы для обогащения ДНК - ферментативная фрагментация ДНК

Подготовка ДНК Illumina с обогащением (ранее известная как Nextera Flex для обогащения) основана на ферментативной фрагментации ДНК с помощью транспосомного фермента. Следующие панели датчиков используются с Illumina DNA Prep с обогащением:


Создание библиотеки NGS

По мере увеличения производительности секвенирования и увеличения масштабов экспериментов создание библиотек для секвенирования часто является ограничивающим этапом. Мы рады обсудить варианты и протоколы, подходящие для ваших конкретных исследовательских проектов. Мы можем подготовить как стандартные, так и специализированные библиотеки различных типов, включая геномную ДНК с вставками разного размера, RNA-seq с рибо-истощением или вариантами, специфичными для цепи, захват экзома, ChIP-seq и microRNA-seq. Мы оптимизировали и автоматизировали подготовку библиотеки и теперь можем создавать до 96 различных библиотек со штрих-кодами, используя IntegenX Apollo 324 робот и Штангенциркуль Sciclone G3 для стабильного качества и быстрого выполнения работ. Мы также можем предоставить обучение и доступ к роботам, если вы хотите использовать инструменты самостоятельно для крупномасштабных проектов.

Исходным материалом для создания библиотеки Illumina обычно является двухцепочечная (ds) ДНК из любого источника: геномная ДНК, ВАС, ПЦР-ампликоны, образцы ChIP, любой тип РНК, превращенный в ds-кДНК (мРНК, нормализованная общая РНК, smRNA) и т. Д. многое из того, о чем вы можете подумать, заканчивается или может быть превращено в дцДНК. Затем эта дцДНК фрагментируется (если это еще не сделано, как в ChIP). Средняя длина фрагмента не должна превышать 600 п.н. (HiSeq 2500, MiSeq) или 350 п.н. (HiSeq 3000). Затем концы ремонтируются, и & # 8216A & # 8217 хвосты, адаптеры лигируются, выполняется выбор размера, затем выполняется ПЦР для создания окончательной библиотеки, готовой к секвенированию. Различные типы библиотек могут различаться по деталям (например, библиотека без PCR), но это основной рабочий процесс. Отличный форум для всех видов вопросов, связанных с последовательностью, на всех платформах - это форум Seqanswers.com.

Количественное определение и чистота образцов ДНК / РНК
Количества входящей ДНК и РНК, указанные ниже и в этой таблице, применяются, если образцы количественно определены флуорометрическим методом (например, Qubit, PicoGreen, RiboGreen). Флуорометрия обеспечивает преимущества в точности и специфичности (например, красители ДНК не связываются с РНК и не измеряют ее). Если используется спектрофотометр (например, Nanodrop), мы предлагаем сдавать вдвое больше требуемого количества пробы, поскольку этот тип измерения часто бывает ненадежным. В любом случае количество образцов, превышающее минимальные требования, повысит сложность библиотеки. Показания спектрофотометра очень полезны для оценки чистоты образцов. Для образцов ДНК соотношение 260/280 должно быть от 1,8 до 2,0, а соотношение 260/230 должно быть выше 2,0. Для образцов РНК соотношение 260/280 должно быть между 1,8 и 2,1, а соотношение 260/230 должно быть выше 1,5. Значения вне этих диапазонов указывают на загрязнение. Ядро для ПЦР в реальном времени может выполнять экстракцию как ДНК, так и РНК.

Услуги по подготовке библиотеки для секвенирования: требования к образцам

См. Также полную таблицу требований.

Библиотеки на основе ДНК

Технические характеристики производимых нами библиотек зависят от исходного материала. Геномная ДНК, библиотеки двухцепочечной кДНК, ВАС или другой материал, доступный в микрограммах, почти каждый раз будут создавать качественные библиотеки.

Рекомендации по подаче ДНК, достойной библиотеки
Обеспечьте 2 мкг или более высококачественной ДНК (концентрация> 50 нг / мкл, OD 260/280, близкая к 1,8 отношение 260/230> gt2,0) в буфере EB или TE (предпочтителен буфер EB) или воде, пригодной для молекулярной биологии. Можно также попытаться построить библиотеку из меньшего количества входного материала, но с оговорками. Если общий входной материал для подготовки библиотеки составляет менее 100 нг, необходимо использовать специальные протоколы подготовки библиотеки. Для библиотек без ПЦР рекомендуется количество образцов 5 мкг ДНК, возможно использование меньшего количества.

Библиотеки чипов
Мы предлагаем создание библиотеки из материала, подвергнутого иммунопреципитации хроматина. Для этих более сложных экспериментов рекомендуется обсудить с основным персоналом вопрос о пригодности исходного материала и стратегии строительства. Эта библиотечная услуга не дает никаких гарантий, за исключением того, что мы сделаем все, что в наших силах! В качестве общего сведения могут быть интересны Техническая записка ChIP-Seq Data и Таблица данных ChIP-Seq от Illumina.

Библиотеки сопряженных пар
Секвенирование библиотек Mate Pair генерирует считывание парных концов с длинной вставкой. Библиотеки создаются путем самолигирования длинных фрагментов ДНК и мечения участков соединения для создания молекул химерной библиотеки, которые объединяют последовательности, которые изначально были разнесены на 2–12 т.п.н. Мы используем набор Illumina Nextera Mate Pair, в котором используется фермент транспозаза для фрагментации, а также для концевых меток ДНК за один этап. Метки биотинилированы и, таким образом, позволяют выбирать участки соединения, содержащие фрагменты. В отличие от более старых протоколов библиотеки парных пар, набор Nextera очень надежен, за исключением определения размера исходных фрагментов. Как и во всех других анализах длинных фрагментов ДНК, качество ДНК имеет значение. Пожалуйста, отправьте нам гелевое изображение по электронной почте перед отправкой образцов ДНК. Образцы должны работать в виде полосы размером 20 КБ или более на агарозном геле.
Набор Nextera предлагает два протокола: версию & # 8220gel-free & # 8221 (ввод 1 мкг), которая представляет наибольший интерес, когда доступно лишь небольшое количество вводимой ДНК. Размеры парных фрагментов из этого протокола обычно варьируются от 1,5 до 10 КБ. Как ни странно, скаффолдер SSPACE все еще может работать с этими данными.
Версия & # 8220gel-plus & # 8221 требует минимум 4 мкг входной ДНК (и в 4 раза больше реагентов) и использует экстракцию геля для выбора размера фрагментов в диапазоне + - 700 п.н. для более коротких партнеров и в пределах + - 2кБ для более длинных. товарищи размером от 10 до 12 кб. Из-за неопределенности фрагментации, пожалуйста, предоставьте как минимум вдвое больше образца.
Теоретически размеры фрагментов, полученные в результате мечения, зависят только от количества входящей ДНК. На практике длины фрагментов значительно различаются между разными образцами ДНК схожего количества. Эту вариабельность между образцами можно наблюдать даже после точного количественного определения ДНК с помощью флуорометрии. Однако реакции можно настраивать для аликвот одного и того же образца. Особенно, если требуются очень конкретные диапазоны размеров, часто необходимо повторять реакцию мечения с отрегулированными количествами ДНК. Затем мы могли бы объединить фракции экстракции геля аналогичного размера из двух реакций мечения для создания библиотек высокой сложности для желаемых диапазонов размеров. Сообщите нам, насколько важны конкретные диапазоны размеров пластин для вашего проекта.
Из-за трудностей с предсказанием диапазонов размеров фрагментов мы указываем скорость перезарядки пары партнеров, включая две реакции мечения. Если мы можем сгенерировать желаемую библиотеку с одной пометкой, мы взимаем меньшую плату за подготовку библиотеки с одной пометкой.

Целевое обогащение
Многие компании предоставляют услуги и платформы, которые генерируют амплификацию всего экзома или мишени. Мы предлагаем массив доступа Fluidigm, в котором используются наножидкости для экономичного выбора мишени для создания библиотек ампликонов со штрих-кодами, готовых для секвенирования Illumina. Библиотеки захвата последовательностей это те, в которых определенные области генома обогащаются после создания индексированной библиотеки и секвенирования. Эта стратегия обеспечивает целенаправленное и очень глубокое секвенирование и может быть реализована для ряда приложений. Несколько компаний предлагают платформы, которые могут генерировать такой материал, включая Illumina, RainDance, Agilent, NimbleGen и Fluidigm. Техническая информация о системах Agilent, Nimblegen, RainDance и Qiagen (в которых для обогащения используется ПЦР, а не стратегия гибридизации) доступна, но ее актуальность не гарантируется. Считайте их отправной точкой для дальнейшего расследования (у нас есть контактная информация для представителей компании, если это необходимо) и исключительно информационного (без подразумеваемого одобрения и т. Д.).

Библиотеки RNA-Seq

Что-то вроде неправильного названия, потому что все библиотеки заканчиваются ДНК, но это относится к исходному материалу. Мы предлагаем подготовку библиотеки RNA-seq с рядом вариантов, таких как рибо-истощение, обогащение поли-A, библиотеки, специфичные для цепи, как описано ниже, а также препараты микро-РНК (miRNA) и библиотеки малых РНК.

Guidelines for Submission of Library-Worthy RNA
Provide at least 1 ug (2 – 5 ug preferred) of total RNA at a concentration of at least 50 ng/ul (1 ug for Poly-A enrichment 2 ug for ribo-depletion libraries using less starting material is possible, but we can’t guarantee results). Please make sure that your RNA isolation protocol employs a DNAse digestion step or other means to remove DNA from the sample. On an agarose gel, DNA contamination will be visible as a smear of band of fragments considerably larger than the RNA (>10 kb). To verify the purity of the RNA samples the 260/280 ratio should be between 1.8 and 2.1 and 260/230 ratio should be higher than 1.5. Poly-A enrichment, ribo-depletion and strand specific library prep are among the commonly requested types of service (more technical details on this appear below). We suggest following the recommendations from Illumina – for human samples use total RNA with a bioanalyzer RIN score of 8 or better, for plant material RIN numbers can be lower and tissue-specific (this is mainly a function of the chloroplast content). Libraries for slightly degraded RNA samples should be prepared using ribo-depletion protocols. If possible please avoid RNA extraction protocols involving Trizol or related phenol containing reagents (silica column based kits are less likely to retain contaminants). If using Trizol, protocols that contain a column based cleanup (e.g. Direct-zol, TRIzolPlus) have to be used. Please note that an additional column cleanup is mandatory for RNA samples isolated from PAXgene tubes or with PAXgene kits. RNA samples should be eluted in molecular biology grade water, always stored in a -80 degree freezer and shipped on dry ice. Все RNA samples require a Bioanalyzer sample QC (or equivalent). Such QC traces can be submitted by the customers or we can run the QC for a fee instead.

Poly-A Enrichment
Total RNA samples can contain up to 90% ribosomal RNA sequences, which are uninformative for transcriptome or gene expression studies, while mRNAs typically make up only 1 to 2% of total RNA. Thus the enrichment of samples for mRNAs is highly desirable. Poly-A enrichment is the most commonly used method to enrich mRNA sequences from eukaryotic total RNA samples mRNAs are selected by hybridization to poly-T oligos bound to magnetic beads.

Ribosomal RNA Depletion
There are multiple commercially available kits to remove ribosomal RNA from your total RNA. The main reason for rRNA depletion is to reduce highly abundant ribosomal RNA especially when transcripts do not carry polyA (bacterial RNA), and also when you desire to retain all long non-coding RNA (lncRNA) and polyA classes of RNA in your sample. Commercial kits containing rRNA removal solution are available for different types of total RNA they include human, mouse, rat, bacteria (gram positive or negative), plant leaf, plant seed and root, and yeast. Ribo depletion protocols can further enable the analysis of slightly degraded RNA samples. We ask for at least 2 ug of total RNA for the preparation ribo-depleted libraries. As always libraries can be generated from less material, but the complexity can suffer.

Micro RNA and Small RNA Libraries
We offer library construction for micro and small RNAs from total RNA using the Illumina protocol and reagents. We size select the libraries with high precision using the Blue Pippin system. The minimum recommended amount of total RNA required for these preps is 1 microgram (recommendations for humans samples). Since the total RNA composition can vary widely between tissues and organisms, please aim to provide at least 2 ug of total RNA. Please also take care that you RNA isolation method actually retains micro and small RNAs. The total RNA samples should be submitted in molecular biology grade water at a concentration of 200 ng/ul. High quality RNA is recommended (the total RNA samples should have RIN scores of 8 or higher according to a Bioanalyzer QC) and should have been DNAse treated before sample submission.

Strand-Specific RNA Libraries
By default we generate strand-specific RNA-seq libraries in the Core. Please let us know if you would prefer the traditional non-stranded library prep instead. Strand-specific (also known as stranded or directional) RNA-seq libraries substantially enhance the value of an RNA-seq experiment. They add information on the originating strand and thus can precisely delineate the boundaries of transcripts in regions with genes on opposite strands, and can determine the transcribed strand of non-coding RNAs. During the cDNA synthesis dUTP is incorporated in the second-stand synthesis. After adapter ligation the dUTP-containing strand is selectively degraded, to preserve strand information for RNA-seq. The forward read of the resulting sequencing data thus represents the “anti-sense strand” and the reverse read the “sense strand” of the genes (for Trinity transcriptome assemblies the “–RF” orientation flag should be used).

Other Library Considerations

PCR-Free Libraries
Libraries generated without amplification will reduce library prep biases. Thus, they can improve the sequencing coverage of genomic areas such as GC-rich regions, promoters, and repeat regions, and enhancing the detection of sequence variants. Please note that PCR-free libraries are more difficult to QC and quantify (please see the bottom of the page) and that the yields tend to be lower for these libraries compared to amplified libraries (10-15%). PCR-free library prep will also require a greater amount of starting material (>5 fold).

Indexed Libraries
Indexing, also called barcoding, allows for the sequencing of multiple libraries in a single lane, i.e., multiplexing. By default all libraries generated by us have a barcode. Multiplexing is required when the typical lane output of 15-25 million reads from the MiSeq, 120-180 million reads from the HiSeq 2500, or 260-310 million reads from the HiSeq 3000 is greater than required for a single library (e.g., in sequencing BACs, PCR generated fragments, small microbial genomes, transcriptomes, exome, ChIP, and small RNA applications). Multiplexing is also the best way to minimize potential lane-to-lane sequencing variation, as all of your samples are subject to the same sequencing conditions. For example, if you require two sequencing lanes for six samples we recommend 6-plexing and sequencing over two lanes, instead of 3-plexing per lane. The principle is that short nucleotide “barcodes” are appended to each library using specific adapters containing those sequences. Libraries containing different indexed adapters are then constructed, quantified, pooled in equimolar amounts, and sequenced. Deconvoluting the barcodes informatically allows multiple libraries to be sequenced in a single lane at a potential cost and time saving. To date, two methods have been exploited for this: using the commercially available indexing kits (Illumina TruSeq, Nextera, or Bioo Scientific) or synthesizing your own adapter oligos with your own barcodes. With the Illumina TruSeq v2 Library Prep Kits A and B you can use up to 24 different barcodes per kit to multiplex up to 48 libraries. Bioo Scientific offers Illumina-compatible barcodes (NEXTflex) with up to 96 barcodes. The Nextera kit (Epicentre/Illumina) uses dual indexing and transposon mediated fragmentation (‘tagmentation’) followed by PCR amplification to integrate barcoded adapters (so a PCR-free library is not an option using the Nextera kit). The dual indexing/adapter tagging strategy (with up to 12 indices available for adapter 1 and up to eight indices for adapter 2) permits up to 96 unique dual index combinations.

Homemade indexing has been used successfully by multiple users. Please avoid the “in-line” barcoding strategy and use Truseq or Nextera-style adapter designs instead (i.e. the barcodes are read in a separate read and do not interfere with cluster registration). It is important to ensure that the base composition of the indices are balanced to optimize the ability of the image analysis software to distinguish signals.

Libraries: Make Your Own

Library construction involves DNA fragmentation (if necessary, depending on the nature of the initial sample), enzymatic treatment of the DNA to repair and A-tail the fragments, ligation of sequencing adapters to these fragments, then subsequent PCR amplification (or skip this for PCR-free libraries), with or without size selection depending on the application. See below for more information on these various aspects of library construction. We also offer Next-Gen Library Prep Training Workshop for comprehensive hands-on training on how to prepare high quality libraries for Illumina sequencing.

Фрагментация
DNA to be made into a sequencing library must first be converted into small fragments. The average insert length should not exceed 600 bp (HiSeq 2500, MiSeq) or 350 bp (HiSeq 3000). There are several methods for doing this, each with attendant pros and cons. Many protocols and centers rely on and recommend a fragmentation device from Covaris, which uses adaptive focused acoustics to break the DNA into appropriately sized fragments. The Covaris E220 can meet the demands of high throughput library production. We primarily use a Covaris E220 and Diagenode Bioruptor NGS (or Bioruptor UCD-200). Access to these instruments is available through the Core, with the usual training and sign up guidelines for Core-available equipment in effect.

Basic DNA and RNA Library Protocols
We use library kits from Illumina, Wafergen, Kapa Biosystems, Bioo Scientific, CloneTech, and NuGen as a source of the fragment repair, tailing, and amplification enzymes. There are a number of other next-gen related products currently being used in the research community. For mRNA-seq libraries we are currently using the stranded Illumina kit. New products are out there and we encourage you to do research if RNA-seq libraries are of interest. In particular, ribosomal RNA depletion protocols that integrate with Illumina kit, and novel RNA amplification and library production resources from NuGen and CloneTech, have expanded the services we offer and will no doubt continue to do so. In other words, keep checking this site to see how things evolve.

The Illumina Adapter Oligonucleotides
The oligonucleotide sequences of the Illumina adapters are available здесь . Illumina tends to sell their adapters only in conjunction with library prep kits. Other vendors of fully compatible ready-to-go adapters include Bioo Scientific. Custom synthesis from companies like MWG-Eurofins, Bioneer, and IDT is another valid option. Two things to note – the “top” Indexed adapter (starting with GATC) must be phosphorylated, and the “bottom” Universal adapter can be synthesized with a special linkage between the 3′ terminal T and the preceding C. This phosphorothioate linkage renders the overhanging T (after annealing the top and bottom adapter oligos) more nuclease resistant, diminishing the probability of adapter dimers (more on adapter dimers below).

Libraries: Quality Control (QC)

Library quality is the single most important determinant of the success of your sequencing run, both in terms of the number of reads generated (quantification) and the validity of the sequence obtained (content). Methods for construction and analysis continue to evolve while now somewhat dated a useful early paper by Quail et al. from the Sanger Institute lists a number of improvements over the standard Illumina protocols in library preparation and analysis. If you construct your own libraries you may want to download this paper and a supplementary methods table for the many practical issues covered. We carry out two QC measures on all libraries sequenced in our Core – examination on the Agilent Bioanalyzer, and quantification using the Kapa Biosystems Illumina Library Quantification Kit.

The Bioanalyzer provides a detailed visual examination of the libraries. The “perfect” library electropherogram, pictured here, shows a single peak of the expected molecular weight. Common additional forms include primer dimers (at around 80-85 bases), adapter dimers (around 120 bases), and broader bands of higher MW than the expected peak. Primer dimers, minimized by the use of magnetic beads, are not a problem unless they completely dominate the reaction. Adapter dimers can be a problem because they will sequence much more efficiently. As a result, whatever the proportion of adapter dimers in your library will be seen as an even higher percentage of reads in your final data files. Adapter dimers can be minimized by adjusting the adapter:insert ratio during library construction and exercising care in gel extraction or other size selection steps. The larger MW, typically more hump-shaped forms that are visualized on the Bioanalyzer are probably a result of excess amplification during the final PCR step. While some amount of these are tolerable, if they are too prominent then the library should be re-amplified from the gel extracted material.

We use a qPCR assay for library quantification – the Kapa Biosystems qPCR assay is run on all the libraries we sequence (and is included in the sequencing price). This has allowed us to provide much more consistent cluster values, which translates to more consistent read numbers. For long runs in particular it’s essential to maximize the data recovered given the time and money involved, which is why we recommend this quantification so strongly.

Library Requirements, Submission, and Storage

Submission
We must receive electronic ([email protected]) and print copies (submitted together with samples) of the appropriate submission form. All customer submitted libraries should be accompanied by Bioanalyzer (or similar) traces. If no traces are submitted we will carry out the Bioanalyzer analysis for a fee. Please visit the Sample Submission & Scheduling page to download submission forms and for more detailed instructions. The same form is currently used for both library preparation and library sequencing submissions. Please contact us if you have any questions about the required information it is essential that you fill in all the information to minimize the chance for error on these expensive and time consuming experiments. One thing we need to know is the approximate insert size desired in the absence of specific preferences we recommend about 220 bp for most mRNA and DNA libraries, but insert sizes should be larger for the longer read MiSeq runs. For certain applications, such as de novo assembly, a range of sizes may be desired and we can accommodate that. But again, we strongly recommend verifying the suitability of these values for the experiment you are trying to do.

Sequencing Library Requirements
The standard requirements for library submission are at least 15 ul volume at a concentration of 5 nM (e.g., 2.3 ng/ul given a 700 bp library). More volume and/or higher concentration is welcome. We can work with less library (down to 1 nM), but the quantification becomes less reproducible, the library becomes less stable, and relatively larger amounts of library DNA stick to the sides of the storage tube. Lower sequencing yield is the likely outcome for library concentrations 1 nM or less, and we cannot guarantee the data quantity or quality for such libraries. The best buffer to ​store and submit libraries is 10 mM Tris​/0.01% Tween-20 ph=8.0 or 8.4​, but EB buffer is also acceptable​​. If possible ​please use 0.6 ml or 1.5 ml low-bind tubes. If you do not provide a Bioanalyzer trace (or equivalent) of your library, we will do this for a fee. Please note, the DNA insert size(s) should not exceed 700 bp and most Illumina adapters add about 120 bases to the fragment length as observed on the Bioanalyzer. When submitting your libraries for sequencing, please use our Illumina Sequencing Submission Form (hard copy with samples, and email to [email protected]), provide the Bioanalyzer profile, library prep methods, and index sequences used. We will measure the quantity of your libraries using real-time PCR (included in the sequencing price).

Libraries for HiSeq 3000 sequencing – The latest generation of sequencers has more stringent library requirements and requires higher library concentrations. The average insert size should ideally be 350 bp and the “tail” of longer fragments should not exceed 550 bp. The new clustering chemistry is more sensitive to adapter dimers: a 5% adapter-dimer contamination can result in 60% of the reads coming from these dimers. Thus it is very important that there is no indication of an adapter-dimer peak (around 120 bp) on the Bioanalyzer trace. Our preferred requirements for library submission are for at least 15 ul volume of 5 nM concentration (e.g., 1.6 ng/ul given a 470 bp library). More volume and/or higher concentration is welcome. Lower sequencing yield is the likely outcome for library concentrations 2 nM or less, and we cannot guarantee the data quantity or quality for such libraries.

PCR-free Libraries QC – The quality of these libraries is difficult to assess. The adapters of these libraries are partly single-stranded. Thus they tend to migrate slower than the fully double-stranded amplified libraries on the Bioanalyzer. In most cases the libraries appear to be 70 to 100 nt longer than they actually are – however the bioanalyzer traces can also be off by far larger margins (e.g. 500 bases). To be sure about the actual library fragment lengths we highly recommend to PCR-amplify an aliquot (1 ul) of the libraries with 8 PCR cycles and run both the PCR-free and the amplified sample on the Bioanalyzer. If multiple PCR-free libraries will be pooled, you might consider quantifying the individual libraries by qPCR before pooling.

Custom Sequencing Primers Please note that these are used only for a small minority of sequencing projects. Custom sequencing primers need to be submitted at a concentration of 100 uM and a volume of 20 ul each together with the libraries. Please make sure that the sequencing primer design fits the chosen Illumina platform. Miseq and Hiseq platforms use different annealing temperatures.

Планирование
Once your library, or library raw material, is ready, you should deliver it as soon as possible to get the next available slot in the queue. Runs occur as we fill up the two (rapid mode) or eight (high-output mode) lanes on a HiSeq flow cell, and the timing on this can vary depending on service type and Core activity. For MiSeq runs the turnaround time is typically five to eight days, while you should allow three to five weeks for HiSeq sequencing in both cases allow an extra one to two weeks for library prep. The HiSeq sequencing scheduling calendar is now available on our website.

Sample/Library Storage Policy
Please let us know if you would like to pick up your samples/libraries after they have been sequenced and we will be happy to accommodate you otherwise, due to space limitations, they will be stored for only six months after sequencing runs have been completed.


Understanding Illumina Adapters - Biology

Sequencing random fragments of DNA is possible via the addition of short nucleotide sequences which allow any DNA fragment to:

  1. Bind to a flow cell for next generation sequencing
  2. Allow for PCR enrichment of adapter ligated DNA fragments only
  3. Allow for indexing or 'barcoding' of samples so multiple DNA libraries can be mixed together into 1 sequencing lane (known as multiplexing)

During library preparation each DNA fragment gets and addional A overhang added to both ends.

The sequencing adapters are the following:

The stars indicate a phosphorothioate bond between the last C and T to prevent cleaving off the last T that is needed for annealing the overhang. The phosphate group on the indexed adapter is required to ligate the adapter to the DNA fragment.

The NNNNNN in the indexed adapter above represents the barcode. Reverse the indexed adapter and note how the last 12 bases are complementary.

Once ligated to a DNA fragment the following arrangement will occur. Left side of the fragment will be:

The right side of the fragment will contain

Both ends before and after the annealed part are "floppy", hanging off.

The PCR Primer 1.0 is identical to the first 44 bases of the TrueSeq Adapter

The PCR Primer 2.0 is the reverse complement of the last 24 bases of the Indexed Adapter

The resulting PCR product will look like this for both strands:

where U stands for the Trueseq Adapter, S stands for DNA sequence that is to be sequenced and I stands for the Trueseq Indexed Adapter. The U will bind to the flowcell.

It is important to remeber that the S sequence could originate from both strands but the sequencing will only process reads that have a the U on the forward strand.

Created by Istvan Albert &bull Last updated on Thursday, December 11, 2014 &bull Site powered by PyBlue